Poster viewing session 2
Tracks
Thursday, 23 May
| Thursday, May 23, 2019 |
| 10:15 - 11:15 |
Speaker
Dr. Alberto Borghetti
Resident
Catholic University Of Sacred Heart
Lamivudine-based maintenance 2-drugs regimens: an algorithm for the estimation of 2-years risk of virological failure in clinical practice
Abstract
Background Dual therapies (DT) with lamivudine (3TC) plus either a boosted protease inhibitor (PI) or dolutegravir (DTG) have shown good efficacy as maintenance antiretroviral therapies (ARVs) but some patients (pts) could be at risk of virological rebound.
Material and methods We retrospectively evaluated the predictors of virological failure (VF, i.e. a single HIV-RNA≥1000 cp/mL or 2 consecutive HIV-RNA≥50 cp/mL) in virologically-suppressed pts (i.e., with undetectable HIV-RNA according to the centre-specific threshold) from 3 clinical centres switching to 3TC plus either boosted darunavir/r (bDRV), atazanavir/r (bATV), lopinavir (bLPV) or DTG from any other ARV. Multivariate Cox regression was used to identify predictors of VF at 2 yrs. The Cox model was then transformed into a point-based rule, by approximating the contribution of specific risk factors in determining VF and by estimating the overall risk of VF at 2 yrs for different scores (as described by Sullivan et al., Statist. Med. 2004; 23:1631–1660). The discriminatory power of the prediction rule was expressed as the area under the receiver-operator characteristic curve (ROC AUC).
Results Overall, 703 pts were eligible for the study: 17.2% of them started bATV, 37.6% bDRV, 4.1% bLPV, 41.1% DTG. They were mostly men (70.1%), reporting heterosexual (40.8%) intercourses as risk factor for HIV, with 50 yrs of median age, 11 yrs since HIV diagnosis and 8 yrs of cumulative ARV exposure. Characteristics of study population are summarized in table 1.
Over 2 years of median follow-up time, 58 VFs occurred (4.1 VFs per 100 pt-years of follow-up). Non-B viral subtype (vs B, aHR 3.06, p=0.002), CD4 count nadir (per 100 cells/mm3 more, aHR 0.83, p=0.063), residual HIV-RNA (per 1 cp/mL more, aHR 1.03, p=0.002), yrs since HIV diagnosis (per 1 yr more, aHR 1.08, p<0.001) and time with HIV-RNA<50 cp/mL before switching to the DT (per 1 month more, aHR 0.99, p=0.011) independently predicted VF. Considering the risk associated with an increase of 10 cp/mL of baseline residual HIV-RNA as the reference point, 4 points were attributed to non-B subtype, -2 to 1 point to different nadir CD4 categories, 0 to 3 points to different residual HIV-RNA categories, -1 to 4 points to different HIV duration categories, -4 to 2 points to different months of virological suppression at the DT start. A point total<0 and ≥11 reflected a risk of VF at 2-yrs <0% and ≥20%, respectively (table 2). The ROC AUC was 0.70 (IQR, 0.63-0.76; see fig. 1). The cut-point to maximise Youden’s J was 5, corresponding to a sensitivity, specificity, positive and negative predictive values for predicting VF of 65.5%, 65.7%, 14.7% and 95.5%, respectively.
Conclusions Some viro-immunological characteristics of pts switching to a 3TC-based maintenance DT can predict the risk of VF and could be incorporated in a clinically-useful algorithm. Validation of the derived score in a different cohort is necessary to confirm these results.
Material and methods We retrospectively evaluated the predictors of virological failure (VF, i.e. a single HIV-RNA≥1000 cp/mL or 2 consecutive HIV-RNA≥50 cp/mL) in virologically-suppressed pts (i.e., with undetectable HIV-RNA according to the centre-specific threshold) from 3 clinical centres switching to 3TC plus either boosted darunavir/r (bDRV), atazanavir/r (bATV), lopinavir (bLPV) or DTG from any other ARV. Multivariate Cox regression was used to identify predictors of VF at 2 yrs. The Cox model was then transformed into a point-based rule, by approximating the contribution of specific risk factors in determining VF and by estimating the overall risk of VF at 2 yrs for different scores (as described by Sullivan et al., Statist. Med. 2004; 23:1631–1660). The discriminatory power of the prediction rule was expressed as the area under the receiver-operator characteristic curve (ROC AUC).
Results Overall, 703 pts were eligible for the study: 17.2% of them started bATV, 37.6% bDRV, 4.1% bLPV, 41.1% DTG. They were mostly men (70.1%), reporting heterosexual (40.8%) intercourses as risk factor for HIV, with 50 yrs of median age, 11 yrs since HIV diagnosis and 8 yrs of cumulative ARV exposure. Characteristics of study population are summarized in table 1.
Over 2 years of median follow-up time, 58 VFs occurred (4.1 VFs per 100 pt-years of follow-up). Non-B viral subtype (vs B, aHR 3.06, p=0.002), CD4 count nadir (per 100 cells/mm3 more, aHR 0.83, p=0.063), residual HIV-RNA (per 1 cp/mL more, aHR 1.03, p=0.002), yrs since HIV diagnosis (per 1 yr more, aHR 1.08, p<0.001) and time with HIV-RNA<50 cp/mL before switching to the DT (per 1 month more, aHR 0.99, p=0.011) independently predicted VF. Considering the risk associated with an increase of 10 cp/mL of baseline residual HIV-RNA as the reference point, 4 points were attributed to non-B subtype, -2 to 1 point to different nadir CD4 categories, 0 to 3 points to different residual HIV-RNA categories, -1 to 4 points to different HIV duration categories, -4 to 2 points to different months of virological suppression at the DT start. A point total<0 and ≥11 reflected a risk of VF at 2-yrs <0% and ≥20%, respectively (table 2). The ROC AUC was 0.70 (IQR, 0.63-0.76; see fig. 1). The cut-point to maximise Youden’s J was 5, corresponding to a sensitivity, specificity, positive and negative predictive values for predicting VF of 65.5%, 65.7%, 14.7% and 95.5%, respectively.
Conclusions Some viro-immunological characteristics of pts switching to a 3TC-based maintenance DT can predict the risk of VF and could be incorporated in a clinically-useful algorithm. Validation of the derived score in a different cohort is necessary to confirm these results.
Ms. Dorcus Abuya
Senior Medical Laboratory Specialist
National HIV Reference Lab
Laboratory evaluation of Thermofischer HIV-1 genotyping assay as a HIV drug resistance test in Kenya
Abstract
Background
As an effort to meet the UNAIDS 90-90-90 targets, Kenya has made tremendous gains in ART scale up with over 1,000,000 people living with HIV (PLHIV) currently enrolled in HIV care. However, the rise in the number of patients on ART is likely to result in increased risk of emergence and transmission of drug resistance. The National HIV Reference Lab (NHRL) of Kenya is mandated by the Ministry of Health to offer technical support to the national DR surveillances. To achieve this mandate, NHRL was recently equipped with adequate DR equipment . However, before safe utilization of the mentioned DR infrastructure at NHRL, there has to be a laboratory method verification of Thermofischer HIV-1 genotyping assay to verify performance characteristics before being deemed fit for its intended use. We report herein the results of the Thermofischer HIV-1 genotyping assay validation on the plasma sample type.
Methods
EQA panels (n=20) and remnant plasma samples (n=20) with known mutations and subtype previously analyzed at KEMRI HIV-R lab Kisumu were analyzed for DR testing using the Thermofischer genotyping assay at the National HIV Reference Laboratory of Kenya. The results (sequences and DR mutations) were then compared to the available results from the HIV-R lab to determine the accuracy, amplification sensitivity, precision and reproducibility of the Thermofischer assay. The levels of agreement were analyzed using SAS V.9
Results
Of the 40 samples analyzed, Thermofischer assay achieved an accuracy of 99.1% (95% CI: 97.6% - 100%) with an amplification sensitivity of 100% (95% CI: 98.1% - 100%). The precision of thermofischer assay was 100% while reproducibility was 98.1%.
Conclusion
Thermofischer HIV-1 Genotyping assay reported an acceptable performance that would in-turn pave way for its utilization in patient management for the national program. In addition, the NHRL will to support DR testing for protocol-specific studies and national/cohort-based DR surveillances.
As an effort to meet the UNAIDS 90-90-90 targets, Kenya has made tremendous gains in ART scale up with over 1,000,000 people living with HIV (PLHIV) currently enrolled in HIV care. However, the rise in the number of patients on ART is likely to result in increased risk of emergence and transmission of drug resistance. The National HIV Reference Lab (NHRL) of Kenya is mandated by the Ministry of Health to offer technical support to the national DR surveillances. To achieve this mandate, NHRL was recently equipped with adequate DR equipment . However, before safe utilization of the mentioned DR infrastructure at NHRL, there has to be a laboratory method verification of Thermofischer HIV-1 genotyping assay to verify performance characteristics before being deemed fit for its intended use. We report herein the results of the Thermofischer HIV-1 genotyping assay validation on the plasma sample type.
Methods
EQA panels (n=20) and remnant plasma samples (n=20) with known mutations and subtype previously analyzed at KEMRI HIV-R lab Kisumu were analyzed for DR testing using the Thermofischer genotyping assay at the National HIV Reference Laboratory of Kenya. The results (sequences and DR mutations) were then compared to the available results from the HIV-R lab to determine the accuracy, amplification sensitivity, precision and reproducibility of the Thermofischer assay. The levels of agreement were analyzed using SAS V.9
Results
Of the 40 samples analyzed, Thermofischer assay achieved an accuracy of 99.1% (95% CI: 97.6% - 100%) with an amplification sensitivity of 100% (95% CI: 98.1% - 100%). The precision of thermofischer assay was 100% while reproducibility was 98.1%.
Conclusion
Thermofischer HIV-1 Genotyping assay reported an acceptable performance that would in-turn pave way for its utilization in patient management for the national program. In addition, the NHRL will to support DR testing for protocol-specific studies and national/cohort-based DR surveillances.
Mr Ivailo Alexiev
Head Of The National Reference Confirmatory Laboratory Of HIV
NCIPD
Phylogenetic Clusters of HIV-1 Subtype B Demonstrate Development of Local Outbreaks in the Vulnerable Groups in Bulgaria (Preliminary Analysis)
Abstract
Background
Phylogenetic clusters show the evolutionary history of constantly changing viral strains. By means of phylogenetic clusters we analyzed the development of HIV-1 subtype B epidemic in major transmission groups - men who have sex with men (MSM), heterosexuals (HET) and people who inject drugs (PWIDs).
Materials & Methods
In this national representative study we analyzed 534 HIV-1 pol subtype B sequences from individuals infected with HIV-1 and diagnosed between 1988 and 2017. HIV-1 pol gene was sequenced using the Applied Biosystems 3130xl or an OpenGene DNA sequencing systems. HIV-1 subtype B was determined using the automated tool COMET v2.2. The phylogenetic tree was reconstructed with IQ-Tree v1.6.8 and visualized in FigTree v1.4.3. HIV-1 transmission clusters were defined with the ClusterPicker v1.2.3 program with a genetic distance parameter of 1.5% and a bootscan support greater than or equal to 90%. Clusters with three or more sequences were assumed as phylogenetic clusters.
Results
From the analyzed 534 sequences, 475 (89.0%) were from men and 59 (11.0%) from women. The average age at diagnosis was 31.9 years. According to self-reported patients data, 296 (55.4%) were MSM, 218 (40.8%) HET, 16 (3.0%) PWIDs and 4 (0.7%) infected by blood products in the early years of the epidemic. 10 (1.9%) from the individuals were sex workers, of which 8 (80.0 %) men and 2 (20.0%) women. 65 (12.2%) of them reported co-infection with other sexually transmitted infections. Our phylogenetic analysis identified 18 phylogenetic clusters and 31 pairs of closely related sequences. 73 (13.7 %) of the analyzed sequences fall into phylogenetic clusters. The largest cluster was composed of 10 sequences - 7 from MSM and 3 from HET. 12 (66.7%) of the clusters were formed from viral strains isolated only from men and 6 (33.3%) were formed of sequences from both sexes. There weren’t any clusters composed of sequences isolated solely from women. 7 (38.9%) of the transmission clusters contain sequences only from one transmission group (6 from MSM and 1 from HET), 11 (61.1%) of the clusters contained sequences from two or more transmission groups. The largest number of mixed clusters n=9 (81.8%) were formed from MSM and HET, 1 cluster from MSM and PWIDs and 1 cluster from individuals from all of the three transmission groups - MSM, HET and PWIDs.
Conclusions
The phylogenetic clusters in our study represent microepidemic outbreaks showing a rapid dissemination of HIV-1 among a limited number of contact individuals. Strains isolated from MSM most often fall into phylogenetic clusters. The presence of clusters from mixed transmission groups indicates that there is a bridge through which viruses were transmitted from one group to another. There is a possibility that some individuals have not self-reported their actual HIV risk-related behavior. Our study contributes to the clarification of the epidemiological characteristics of HIV-1 subtype B transmission in Bulgaria and highlights the importance of detailed molecular-epidemiological surveillance of the HIV-1 infection among vulnerable groups.
Phylogenetic clusters show the evolutionary history of constantly changing viral strains. By means of phylogenetic clusters we analyzed the development of HIV-1 subtype B epidemic in major transmission groups - men who have sex with men (MSM), heterosexuals (HET) and people who inject drugs (PWIDs).
Materials & Methods
In this national representative study we analyzed 534 HIV-1 pol subtype B sequences from individuals infected with HIV-1 and diagnosed between 1988 and 2017. HIV-1 pol gene was sequenced using the Applied Biosystems 3130xl or an OpenGene DNA sequencing systems. HIV-1 subtype B was determined using the automated tool COMET v2.2. The phylogenetic tree was reconstructed with IQ-Tree v1.6.8 and visualized in FigTree v1.4.3. HIV-1 transmission clusters were defined with the ClusterPicker v1.2.3 program with a genetic distance parameter of 1.5% and a bootscan support greater than or equal to 90%. Clusters with three or more sequences were assumed as phylogenetic clusters.
Results
From the analyzed 534 sequences, 475 (89.0%) were from men and 59 (11.0%) from women. The average age at diagnosis was 31.9 years. According to self-reported patients data, 296 (55.4%) were MSM, 218 (40.8%) HET, 16 (3.0%) PWIDs and 4 (0.7%) infected by blood products in the early years of the epidemic. 10 (1.9%) from the individuals were sex workers, of which 8 (80.0 %) men and 2 (20.0%) women. 65 (12.2%) of them reported co-infection with other sexually transmitted infections. Our phylogenetic analysis identified 18 phylogenetic clusters and 31 pairs of closely related sequences. 73 (13.7 %) of the analyzed sequences fall into phylogenetic clusters. The largest cluster was composed of 10 sequences - 7 from MSM and 3 from HET. 12 (66.7%) of the clusters were formed from viral strains isolated only from men and 6 (33.3%) were formed of sequences from both sexes. There weren’t any clusters composed of sequences isolated solely from women. 7 (38.9%) of the transmission clusters contain sequences only from one transmission group (6 from MSM and 1 from HET), 11 (61.1%) of the clusters contained sequences from two or more transmission groups. The largest number of mixed clusters n=9 (81.8%) were formed from MSM and HET, 1 cluster from MSM and PWIDs and 1 cluster from individuals from all of the three transmission groups - MSM, HET and PWIDs.
Conclusions
The phylogenetic clusters in our study represent microepidemic outbreaks showing a rapid dissemination of HIV-1 among a limited number of contact individuals. Strains isolated from MSM most often fall into phylogenetic clusters. The presence of clusters from mixed transmission groups indicates that there is a bridge through which viruses were transmitted from one group to another. There is a possibility that some individuals have not self-reported their actual HIV risk-related behavior. Our study contributes to the clarification of the epidemiological characteristics of HIV-1 subtype B transmission in Bulgaria and highlights the importance of detailed molecular-epidemiological surveillance of the HIV-1 infection among vulnerable groups.
Mr. Alexandre Augusto Bentaberry Rosa
Student
Federal University Of Para
FREQUENCY OF MUTATIONS OF GENOTYPIC RESISTENCE TO ANTIRETROVIRALS IN PATIENTS LIVING WITH HIV/AIDS IN THE PERIOD OF 2013 TO 2015, IN STATE OF PARÁ, BRAZIL.
Abstract
Introduction: The Human immunodeficiency Virus is able to depress the host immune system by eliminating important defense cells like macrophages and lymphocytes resulting in an Acquired immunodeficiency syndrome (AIDS). The Antiretroviral therapy (ART) is the most commonly used method to contain viral replication. In adittion, treatment adherence has particular relevance to avoid the emergence of virus resistance. Despite advances against AIDS, there is still a great HIV resistance to the drugs implemented for disease control which leads to therapeutic failure. This study aimed to characterize the epidemiological profile of HIV /AIDS patients residing in Pará, regarding their resistance mutations profile, the drugs used in the failed treatment, also identify their HIV-1 subtype most prevalents in Pará, Brazil. All obtained by genotyping test. Materials and Methods: This study is cross-sectional, descriptive retrospective, that included patients living with HIV-1, resinding in Pará. The epidemiological and clinical datas were obtained through information collection in medical records, in which samples were submitted to genotyping test between 2013 to 2015 in Central Laboratory of Pará ( LACEN-PA). All information acquired was edited, tabulated, quantified and presented in an excel spreadsheet. Results: The male gender was predominant with 53%. The group aged from 36 to 45 years presented the highest rates, being the majority considered brown with elementary school as prevailing education attainment. Subtype B was the most prevalent in this study, with the M184V mutation as the most prevalent in the class NRTI with the highest mutations, followed by Protease inhibitors with mutation 41K as the most frequent and ITRNN in third place with mutation 103N as most prevalent. Among the drugs used in the therapy, those with NRTI class showed the highest resistance profile, with 3TC/FTC associated with most of treatment failure, being NNRTI class the second highest frequency of resistance with NVP, and Inhibitors of PR the class with highest susceptibility profil. Thus, mutations may or not generate resistance to drugs, factors such as drug class, as well the mutations profile will define, or not, the resistances appearance. Conclusion: In summary, it’s importante to do pharmacological and genotyping monitoring of each patients submitted to ART to observe mutations appearance and the correlation with their drugs resistance profiles.
Prof. Thomas Bourlet
Head of Gimap EA 3064 Research Team
Infectious Agents and Hygiene Lab, University Hospital of Saint-etienne
Evidence of HIV-1 genital compartmentalization before and after antiretroviral therapy initiation in females recently diagnosed in Bamako, Mali
Abstract
Background. To achieve the 90-90-90 targets assigned by UNAIDS, it is crucial to monitor the antiretroviral therapy (ART) of HIV-1 infected patients, especially in resource-limited countries (RLCs). In addition, little is known about the dynamic of HIV-1 shedding and resistance profiles in the genital reservoir after ART initiation in RLCs, which is critical for evaluating the residual risk of HIV-1 transmission by sexual route in ART-experienced people.
Objectives. To evaluate the immune and viral responses in blood and genital secretions after 12 months of ART in newly HIV-1 diagnosed females in Bamako, Mali; to determine primary and acquired resistance rates to antiretroviral drugs.
Patients and methods. Seventy-four consenting females were enrolled between January and June 2016 at the time of their HIV-1 infection diagnosis. HIV-1 RNA loads (Abbott RealTime HIV-1 assay) were tested in blood and cervicovaginal fluids (CVF) before and at month 3, 6 and 12 after initiation of ART. Primary and acquired resistances to ART were evaluated by Viroseq™ HIV-1 genotyping assay. The vaginal microbiota was analysed by using the IonTorrent™ NGS technology (Thermo Fisher Scientific).
Results. During the study, 9.5% of people deceased and 31.5% were lost to follow-up. Rates of primary drug resistance mutations in blood and CVF were 13.3% and 25%, respectively. Among blood/CVF paired samples tested by genotyping assay and exhibiting resistance mutations, discrepant profiles were observed in 75% of cases. The acquired resistance rate was estimated at 3.1% in blood samples. In the 44 patients tested at month 12 after ART start, undetectable HIV-1 RNA was reached in 84.1% and 77.3% of blood and CVF, respectively. In seven females (15.9%), HIV RNA was detected in CVF but not in the corresponding blood sample. A vaginal dysbiosis was associated with HIV RNA shedding.
Conclusions. Our study evidenced a huge proportion of non-adherent people to ART program but a reassuring high percentage of virological success as well as a low level of acquired mutations in adherent patients after one year of therapy. These findings emphasize the need of reinforcing education to improve retention in care system. We also observed a worrying high primary resistance level to ARV drugs underlying the necessity of regular virological monitoring to optimize the use of therapeutical options. Lastly, the high percentage of persistent HIV-1 RNA in female genital tract despite ART pleads in favor of a systematic screening and treatment of STI in order to decrease the risk of HIV-1 transmission.
Objectives. To evaluate the immune and viral responses in blood and genital secretions after 12 months of ART in newly HIV-1 diagnosed females in Bamako, Mali; to determine primary and acquired resistance rates to antiretroviral drugs.
Patients and methods. Seventy-four consenting females were enrolled between January and June 2016 at the time of their HIV-1 infection diagnosis. HIV-1 RNA loads (Abbott RealTime HIV-1 assay) were tested in blood and cervicovaginal fluids (CVF) before and at month 3, 6 and 12 after initiation of ART. Primary and acquired resistances to ART were evaluated by Viroseq™ HIV-1 genotyping assay. The vaginal microbiota was analysed by using the IonTorrent™ NGS technology (Thermo Fisher Scientific).
Results. During the study, 9.5% of people deceased and 31.5% were lost to follow-up. Rates of primary drug resistance mutations in blood and CVF were 13.3% and 25%, respectively. Among blood/CVF paired samples tested by genotyping assay and exhibiting resistance mutations, discrepant profiles were observed in 75% of cases. The acquired resistance rate was estimated at 3.1% in blood samples. In the 44 patients tested at month 12 after ART start, undetectable HIV-1 RNA was reached in 84.1% and 77.3% of blood and CVF, respectively. In seven females (15.9%), HIV RNA was detected in CVF but not in the corresponding blood sample. A vaginal dysbiosis was associated with HIV RNA shedding.
Conclusions. Our study evidenced a huge proportion of non-adherent people to ART program but a reassuring high percentage of virological success as well as a low level of acquired mutations in adherent patients after one year of therapy. These findings emphasize the need of reinforcing education to improve retention in care system. We also observed a worrying high primary resistance level to ARV drugs underlying the necessity of regular virological monitoring to optimize the use of therapeutical options. Lastly, the high percentage of persistent HIV-1 RNA in female genital tract despite ART pleads in favor of a systematic screening and treatment of STI in order to decrease the risk of HIV-1 transmission.
Dr. Paola Canepa
Prevalence of NS3, NS5A, NS5B resistance associated substitutions through patients who failed a DAA treatment: data collected in Liguria from March 2018 to March 2019.
Abstract
BACKGROUND: The new Direct Acting Antivirals (DAAs) oral regimen demonstrate high efficacy in the treatment of HCV infections, with the achievement of a sustained virological response (SVR) in over 90% of patients. Virological failure is related to the presence of resistance associated substitutions (RAS) in DAAs regimen targets, which may persist for years, affecting the choice of HCV re-treatment options. Here we describe the distribution of NS3, NS5A and NS5B RAS detected in 27 patients who experienced a virological failure during a second generation DAAs regimen in Liguria, from March 2018 to March 2019.
METHODS: From March 2018 to March 2019 a total of 27 serum samples collected from HCV infected patients who had failed to achieve a SVR during a DAAs regimen were analyzed for the presence of RAS in the Laboratory of the Hygiene Unit of Ospedale Policlinico San Martino (Genoa), belonging to the VIRONET-C Italian Network. HCV RNA was extracted using NucliSENS easyMAG system (bioMérieux, Boxtel, The Netherlands) and genomic regions were amplified with specific HCV genotype/subtype primers, in two steps PCR. Subsequently, cDNA of the three genomic targets (NS3, 1-181aa; NS5A, 1-213aa; NS5B, 219-347aa) was purified and sequenced by 3130-Avant Genetic Analyzer (Life Technologies, NY, USA). Sequences were aligned by SeqScape Ver. 3.3 Software (Life Technologies, NY, USA). Mutations and predictions of phenotypic resistance were obtained using Geno2pheno tool (latest version available at the time of our analysis). (http://www.geno2pheno.org/).
RESULTS:
Serum samples were collected from 27 DAAs failed patients (9 Female,18 Male), median age 61 years, out of 2774 treated in our region (0,97%). Genotypes distribution was the following: 9/27 (33,3%) 3a, 8/27(29,6%) 1a, 7/27 (26%) 1b, 2/27 (7,4%) 4a; two different genotypes (1b, 3a) were detected in 1/27 (3,7%) patient. Treatments administered were the following: Elbasvir /Grazoprevir in 10/27 (37,0%), Sofosbuvir / Velpatasvir in 14/27 (52%), Glecaprevir /Pibrentasvir in 3/27 (11,0%). The pan-genotypic 93H RAS was found in 10/27 (37,0%) patients who failed an NS5A non-structural protein inhibitor with the higher prevalence in patients who received an Elbasvir/Grazoprevir regimen 6/10 (60%). The NS3 Q80K RAS was observed in 2/13 (15,4%) patients after failing a protease inhibitor. No clinically relevant RAVs were detected in NS5B region. No significant difference was observed between genotypes.13/27 (48%) patients failed to obtain a SVR without RAS.
DISCUSSION
This study showed an excellent efficacy of DAAs treatment of HCV infections, with a rate of failure <1%, equally distributed among the three considered drugs. Despite the small number of analyzed patients, in our cohort a more elevated prevalence of NS5A RAS seems to be identified in patients treated with Elbasvir/Grazoprevir respect to those who received either a Sofosbuvir/Velpatasvir or a Glecaprevir/Pibrentasvir regimen, Of note, 48% of virologic failure occur without the presence of clinically relevant RAS, thus suggesting limited implications in term of therapy failure during a second line regimen. Nevertheless, RAS screening at failure may confer some advantage in re-treatment options choice for those patients found to harbor resistant viruses.
METHODS: From March 2018 to March 2019 a total of 27 serum samples collected from HCV infected patients who had failed to achieve a SVR during a DAAs regimen were analyzed for the presence of RAS in the Laboratory of the Hygiene Unit of Ospedale Policlinico San Martino (Genoa), belonging to the VIRONET-C Italian Network. HCV RNA was extracted using NucliSENS easyMAG system (bioMérieux, Boxtel, The Netherlands) and genomic regions were amplified with specific HCV genotype/subtype primers, in two steps PCR. Subsequently, cDNA of the three genomic targets (NS3, 1-181aa; NS5A, 1-213aa; NS5B, 219-347aa) was purified and sequenced by 3130-Avant Genetic Analyzer (Life Technologies, NY, USA). Sequences were aligned by SeqScape Ver. 3.3 Software (Life Technologies, NY, USA). Mutations and predictions of phenotypic resistance were obtained using Geno2pheno tool (latest version available at the time of our analysis). (http://www.geno2pheno.org/).
RESULTS:
Serum samples were collected from 27 DAAs failed patients (9 Female,18 Male), median age 61 years, out of 2774 treated in our region (0,97%). Genotypes distribution was the following: 9/27 (33,3%) 3a, 8/27(29,6%) 1a, 7/27 (26%) 1b, 2/27 (7,4%) 4a; two different genotypes (1b, 3a) were detected in 1/27 (3,7%) patient. Treatments administered were the following: Elbasvir /Grazoprevir in 10/27 (37,0%), Sofosbuvir / Velpatasvir in 14/27 (52%), Glecaprevir /Pibrentasvir in 3/27 (11,0%). The pan-genotypic 93H RAS was found in 10/27 (37,0%) patients who failed an NS5A non-structural protein inhibitor with the higher prevalence in patients who received an Elbasvir/Grazoprevir regimen 6/10 (60%). The NS3 Q80K RAS was observed in 2/13 (15,4%) patients after failing a protease inhibitor. No clinically relevant RAVs were detected in NS5B region. No significant difference was observed between genotypes.13/27 (48%) patients failed to obtain a SVR without RAS.
DISCUSSION
This study showed an excellent efficacy of DAAs treatment of HCV infections, with a rate of failure <1%, equally distributed among the three considered drugs. Despite the small number of analyzed patients, in our cohort a more elevated prevalence of NS5A RAS seems to be identified in patients treated with Elbasvir/Grazoprevir respect to those who received either a Sofosbuvir/Velpatasvir or a Glecaprevir/Pibrentasvir regimen, Of note, 48% of virologic failure occur without the presence of clinically relevant RAS, thus suggesting limited implications in term of therapy failure during a second line regimen. Nevertheless, RAS screening at failure may confer some advantage in re-treatment options choice for those patients found to harbor resistant viruses.
Prof. Charlotte Charpentier
Professor
Hôpital Bichat-Claude Bernard
Efficacy of DTG-based + PI dual-class therapy in an observational cohort
Abstract
Background: Dual-class therapies including the INSTI dolutegravir (DTG) associated with rilpivirine or with lamivudine have shown their efficacy to maintain virological suppression in well-selected virologically-suppressed patients with no previous virological failure. Here, we report an observational cohort study of patients switching to a dual-class therapy containing DTG and a protease inhibitor (PI) (darunavir [DRV] or atazanavir [ATV]).
Patients & Methods: A prospective observational cohort enrolling all patients initiating DTG+DRV/r or DTG+ATV(+/-r) between January 2016 and January 2018. Plasma viral loads (pVL) were performed using Cobas-Taqman HIV-1 V2.0 assay. Plasma drug concentrations were measured using UPLC-MS/MS.
Results: Fifty-four patients were assessed in this observational cohort, 38 received DTG+ATV(+/-r) and 16 received DTG+DRV/r. Median age was 55 years (IQR=48-61) and 37 were men (69%). Thirty-eight patients (70%) had a pVL <50 c/mL at time of DTG-based dual-therapy initiation with a significant longer duration of virological suppression in the ATV group than in the DRV group (7.9 versus 1.2 years, p=0.02). Twenty-seven patients (50%) were already receiving a dual-therapy before DTG-based dual-therapy initiation, including raltegravir (RAL) in 14 cases. An historical genotypic resistance test was available in 49 patients showing viruses with NRTI or NNRTI drug resistance mutations (DRM) in 41 cases and in 34 cases, respectively. A major PI DRM was reported in six cases (12%) including an ATV DRM (N88S) in one case. Three of the 27 integrase available sequences showed INSTI DRM selected at failure of a previous INSTI-based regimen (E138K, Y143R and S147G-N155H-S230R). GSS could be measured for 25 patients and was equal to 2 in 21 cases and to 1 in four cases. One comorbidity has been reported in 35 patients (65%). A comedication was prescribed in 41 patients (76%) with a drug-drug interaction evidenced in three cases in the DRV group and in ten cases in the ATV group. Median time of follow-up of DTG-based dual-therapy was 2.1 years (IQR=1.3-2.9). Three patients (5.6%) discontinued DTG-based dual-therapy due to adverse events. Median CD4-cell counts at baseline and at the last follow-up of DTG-based dual-therapy were 580/mm3 (IQR=418-774) and 586/mm3 (IQR=458-800), respectively. The median gain of CD4 cell count was +30/mm3 (IQR=-47; +120). Two patients (3.7%, CI95%: 0-8.8%) experienced a virological failure (VF) with no selection of additional DRM compared to their historical genotype; one in the DRV/r group and one in the ATV/r group. Dual-class therapy was fully active (GSS=2) in both cases of VF. Eight patients (14.8%, CI95%: 5.2-24.4%) had a viral blip during the duration of follow-up (5 in the DRV/r group and 3 in the ATV/r group). Plasma drugs concentrations were available in 30 and 14 patients in the ATV and the DRV groups, respectively showing adequate DTG concentrations in all patients except two in the DRV group.
Conclusions: We report a good virological response to a dual-class DTG-based therapy with ATV or with DTG in an observational cohort showing a VF in 2 patients among 54 with no resistance selection. ATV+DTG is a favorable dual-class strategy in terms of pharmacokinetics with increased DTG concentrations.
Patients & Methods: A prospective observational cohort enrolling all patients initiating DTG+DRV/r or DTG+ATV(+/-r) between January 2016 and January 2018. Plasma viral loads (pVL) were performed using Cobas-Taqman HIV-1 V2.0 assay. Plasma drug concentrations were measured using UPLC-MS/MS.
Results: Fifty-four patients were assessed in this observational cohort, 38 received DTG+ATV(+/-r) and 16 received DTG+DRV/r. Median age was 55 years (IQR=48-61) and 37 were men (69%). Thirty-eight patients (70%) had a pVL <50 c/mL at time of DTG-based dual-therapy initiation with a significant longer duration of virological suppression in the ATV group than in the DRV group (7.9 versus 1.2 years, p=0.02). Twenty-seven patients (50%) were already receiving a dual-therapy before DTG-based dual-therapy initiation, including raltegravir (RAL) in 14 cases. An historical genotypic resistance test was available in 49 patients showing viruses with NRTI or NNRTI drug resistance mutations (DRM) in 41 cases and in 34 cases, respectively. A major PI DRM was reported in six cases (12%) including an ATV DRM (N88S) in one case. Three of the 27 integrase available sequences showed INSTI DRM selected at failure of a previous INSTI-based regimen (E138K, Y143R and S147G-N155H-S230R). GSS could be measured for 25 patients and was equal to 2 in 21 cases and to 1 in four cases. One comorbidity has been reported in 35 patients (65%). A comedication was prescribed in 41 patients (76%) with a drug-drug interaction evidenced in three cases in the DRV group and in ten cases in the ATV group. Median time of follow-up of DTG-based dual-therapy was 2.1 years (IQR=1.3-2.9). Three patients (5.6%) discontinued DTG-based dual-therapy due to adverse events. Median CD4-cell counts at baseline and at the last follow-up of DTG-based dual-therapy were 580/mm3 (IQR=418-774) and 586/mm3 (IQR=458-800), respectively. The median gain of CD4 cell count was +30/mm3 (IQR=-47; +120). Two patients (3.7%, CI95%: 0-8.8%) experienced a virological failure (VF) with no selection of additional DRM compared to their historical genotype; one in the DRV/r group and one in the ATV/r group. Dual-class therapy was fully active (GSS=2) in both cases of VF. Eight patients (14.8%, CI95%: 5.2-24.4%) had a viral blip during the duration of follow-up (5 in the DRV/r group and 3 in the ATV/r group). Plasma drugs concentrations were available in 30 and 14 patients in the ATV and the DRV groups, respectively showing adequate DTG concentrations in all patients except two in the DRV group.
Conclusions: We report a good virological response to a dual-class DTG-based therapy with ATV or with DTG in an observational cohort showing a VF in 2 patients among 54 with no resistance selection. ATV+DTG is a favorable dual-class strategy in terms of pharmacokinetics with increased DTG concentrations.
Dr. Gabriel Coltan
Doctor
Institutul National De Boli Infectioase "prof. Dr. Matei Bals"
Early virological response in patients with HCV genotype 1 in treatment with Elbasvir / Grazoprevir
Abstract
Introduction:
In Romania, with a population of 19.6 million inhabitants and a prevalence of 3.23%, are estimated approximately 600,000 patients with HCV infection. Romania holds the 1st place in Europe as a total number of HCV cases, the fourth place as a mortality rate caused by liver disease - 44.5 deaths per 100,000 inhabitants.
Approximately 10% of HCV patients in Europe are Romanians (OMS). Under these circumstances, HCV is a serious public health problem. Currently, there is a national registry of hepatitis, a national screening and treatment program.
The purpose of study is to evaluate the efficacy and safety of a short-term therapeutic regimen, allowing the treatment for more patients with the same financial resources.
Material and methods:
According to the national criteria for inclusion in therapy: detectable viremia and fibrosis > 1 (determined by Fibromax), between November 2018 and February 2019, a number of 32 patients - naive and experienced, aged 33-80 years, were included in the study.
Evaluation of patient viremia was performed at baseline, after 3 weeks of therapy and after 12 weeks (EOT).
Results:
-Of the 32 patients, 23 were evaluated after 3 weeks and after 12 weeks of treatment;
After 3 weeks:
• ND viremia = 13 patients;
• <15UI (detection limit) = 6 patients;
15UI (15-95UI) = 4 patients
After 12 weeks (EOT) - all this patients had undetectable viremia;
-A patient interrupted therapy after 2 weeks of treatment (cardiac decompensation)
-8 patients were evaluated only after 12 weeks of treatment (EOT); all were undetectable.
Adverse effects:
• 1 case- cardiac decompensation hospitalized - discontinuation of therapy
• 1 case -ALT ↑ 10 * N (without discontinuation)
Other side effects: fatigue, headache, muscle pain (intermitent and low intensity).
Conclusions and discussions:
The Elbasvir / Grazoprevir treatment regimen proved to be effective and safe: all patients were undetectable at EOT, few side effects.
Along with other studies, this presentation shows the possibility of shortening the duration of therapy (8 weeks), thus allowing:
• Increasing adherence;
• Reduction of the possibility of adverse effects;
• Faster return to previous medication that has been changed due to possible drug interactions;
• Increasing the number of patients treated with the same financial resources.
In Romania, with a population of 19.6 million inhabitants and a prevalence of 3.23%, are estimated approximately 600,000 patients with HCV infection. Romania holds the 1st place in Europe as a total number of HCV cases, the fourth place as a mortality rate caused by liver disease - 44.5 deaths per 100,000 inhabitants.
Approximately 10% of HCV patients in Europe are Romanians (OMS). Under these circumstances, HCV is a serious public health problem. Currently, there is a national registry of hepatitis, a national screening and treatment program.
The purpose of study is to evaluate the efficacy and safety of a short-term therapeutic regimen, allowing the treatment for more patients with the same financial resources.
Material and methods:
According to the national criteria for inclusion in therapy: detectable viremia and fibrosis > 1 (determined by Fibromax), between November 2018 and February 2019, a number of 32 patients - naive and experienced, aged 33-80 years, were included in the study.
Evaluation of patient viremia was performed at baseline, after 3 weeks of therapy and after 12 weeks (EOT).
Results:
-Of the 32 patients, 23 were evaluated after 3 weeks and after 12 weeks of treatment;
After 3 weeks:
• ND viremia = 13 patients;
• <15UI (detection limit) = 6 patients;
15UI (15-95UI) = 4 patients
After 12 weeks (EOT) - all this patients had undetectable viremia;
-A patient interrupted therapy after 2 weeks of treatment (cardiac decompensation)
-8 patients were evaluated only after 12 weeks of treatment (EOT); all were undetectable.
Adverse effects:
• 1 case- cardiac decompensation hospitalized - discontinuation of therapy
• 1 case -ALT ↑ 10 * N (without discontinuation)
Other side effects: fatigue, headache, muscle pain (intermitent and low intensity).
Conclusions and discussions:
The Elbasvir / Grazoprevir treatment regimen proved to be effective and safe: all patients were undetectable at EOT, few side effects.
Along with other studies, this presentation shows the possibility of shortening the duration of therapy (8 weeks), thus allowing:
• Increasing adherence;
• Reduction of the possibility of adverse effects;
• Faster return to previous medication that has been changed due to possible drug interactions;
• Increasing the number of patients treated with the same financial resources.
Dr. Rawlings Datir
Postdoctoral Research Associate
University of Cambridge
Four Amino Acid changes near the p17/p24 cleavage site of HIV-1 CRF02_AG isolates confer reduced protease inhibitor susceptibility
Abstract
Background:
Protease Inhibitors (PIs) are the second- and last-line therapy for the majority of HIV-infected patients worldwide as access to third-line therapy is still limited. Only around 10%–20% of individuals who fail PI regimens develop major resistance mutations to PIs by week 48, and this proportion increases over time.
Previous studies showed gag mutations can confer resistance to PIs in the absence of PI resistance mutations inside HIV-1 protease. We studied gag-protease changes within patients who failed PI treatment in a Nigerian treatment program.
Materials & Methods:
Full length gag-protease of baseline (pre-PI) and virological failure (VF) samples of six HIV-1 CRF02_AG and subtype G infected patients was amplified and cloned into a p8.9NSX+ vector. Lopinavir (LPV) susceptibility of the VSV-g pseudotyped viruses was measured using cell-based, single replication-cycle assays. Susceptibility was expressed as IC50 fold-changes between isolate and the HIV-1 subtype B reference strain (p8.9NSX+).
We performed sequence alignment of the isolates identifying gag and protease amino acid substitutions which have occurred. Using site-directed mutagenesis (SDM), roles of the different amino acid changes was studied by reverting the amino acid changes and carrying out drug assays on the mutants.
Results:
No significant differences in fold change (FC) IC50 of LPV in 5 out of 6 patient sample pairs, also these did not exhibit the unique gag mutations observed in the phenotypically-significant patient pair.
One patient had a 5x FC between baseline and VF virus isolates. Sequence alignment of gag-protease of this patient revealed 19 amino acid changes in the p17, one amino acid change in each of p24, p2 and NC as well as an insertion of four amino acids (Glu, Leu, Arg and Glu) in the p6 region and two amino acid changes (positions 14 and 46) between baseline (susceptible) and VF (resistant) isolates. Fold change IC50 to LPV of baseline vs VF isolates was 5.3 vs 20.3 respectively.
When Ser and His residues at positions 126 and 127 respectively were deleted in the susceptible virus, there was a decrease in LPV susceptibility of the mutant virus (FC IC50 from 5.3 to 8.2). Conversely, the insertion of Ser and His residues in the resistant virus increased susceptibility of the mutant (FC IC50 from 20.3 to 13.3).
A combination of S126del, H127del and T122A, G123E mutations in the susceptible virus led to a 4x decrease in susceptibility (FC IC50 from 5.3 to 22.7). Conversely, S126Ins, H127Ins and A122T, E123G in the resistant virus, led to a 3x decrease in resistance (FC IC50 from 20.3 to 7.6). Western blotting of virus containing supernatants from producer cells did not reveal significant cleavage defects at the p17/p24 cleavage site.
Conclusions:
In this failure case of LPV/r- based second line regimen in a Nigerian patient and with no major protease mutations, we provided evidence that the emergence of non-cleavage site gag mutations in the p17 domain which have not been previously described could be associated with PI failure in CRF02_AG viruses. The mechanism of this is currently being studied.
Protease Inhibitors (PIs) are the second- and last-line therapy for the majority of HIV-infected patients worldwide as access to third-line therapy is still limited. Only around 10%–20% of individuals who fail PI regimens develop major resistance mutations to PIs by week 48, and this proportion increases over time.
Previous studies showed gag mutations can confer resistance to PIs in the absence of PI resistance mutations inside HIV-1 protease. We studied gag-protease changes within patients who failed PI treatment in a Nigerian treatment program.
Materials & Methods:
Full length gag-protease of baseline (pre-PI) and virological failure (VF) samples of six HIV-1 CRF02_AG and subtype G infected patients was amplified and cloned into a p8.9NSX+ vector. Lopinavir (LPV) susceptibility of the VSV-g pseudotyped viruses was measured using cell-based, single replication-cycle assays. Susceptibility was expressed as IC50 fold-changes between isolate and the HIV-1 subtype B reference strain (p8.9NSX+).
We performed sequence alignment of the isolates identifying gag and protease amino acid substitutions which have occurred. Using site-directed mutagenesis (SDM), roles of the different amino acid changes was studied by reverting the amino acid changes and carrying out drug assays on the mutants.
Results:
No significant differences in fold change (FC) IC50 of LPV in 5 out of 6 patient sample pairs, also these did not exhibit the unique gag mutations observed in the phenotypically-significant patient pair.
One patient had a 5x FC between baseline and VF virus isolates. Sequence alignment of gag-protease of this patient revealed 19 amino acid changes in the p17, one amino acid change in each of p24, p2 and NC as well as an insertion of four amino acids (Glu, Leu, Arg and Glu) in the p6 region and two amino acid changes (positions 14 and 46) between baseline (susceptible) and VF (resistant) isolates. Fold change IC50 to LPV of baseline vs VF isolates was 5.3 vs 20.3 respectively.
When Ser and His residues at positions 126 and 127 respectively were deleted in the susceptible virus, there was a decrease in LPV susceptibility of the mutant virus (FC IC50 from 5.3 to 8.2). Conversely, the insertion of Ser and His residues in the resistant virus increased susceptibility of the mutant (FC IC50 from 20.3 to 13.3).
A combination of S126del, H127del and T122A, G123E mutations in the susceptible virus led to a 4x decrease in susceptibility (FC IC50 from 5.3 to 22.7). Conversely, S126Ins, H127Ins and A122T, E123G in the resistant virus, led to a 3x decrease in resistance (FC IC50 from 20.3 to 7.6). Western blotting of virus containing supernatants from producer cells did not reveal significant cleavage defects at the p17/p24 cleavage site.
Conclusions:
In this failure case of LPV/r- based second line regimen in a Nigerian patient and with no major protease mutations, we provided evidence that the emergence of non-cleavage site gag mutations in the p17 domain which have not been previously described could be associated with PI failure in CRF02_AG viruses. The mechanism of this is currently being studied.
Dr Dominik Duelli
Manager R&d
Abbott Molecular
Design and Performance Characteristics of the new Alinity m Hepatitis B Virus (HBV) Viral Load Assay
Abstract
Background:
Currently 3.5% (257 million) of people worldwide have chronic HBV infection. Chronic HBV infection can cause liver cirrhosis, hepatocellular carcinoma, and other diseases. Current guidelines recommend screening populations with HBV surface antigen and using a viral load assay to identify patients requiring therapy. The Alinity m HBV viral load assay was developed to achieve broad genotype inclusivity (A-I), high sensitivity, and a wide dynamic range. Here we evaluate key performance attibutes of the Alinity m HBV assay.
Methods:
The primer/probe target region was developed based on analysis of sequences from genotypes A-I in collaboration with Abbott’s Global Surveillance program. The Alinity m System utilizes magnetic microparticle sample preparation chemistry, unit-dose lyophilized amplification reagents, and ReadiFlex™ sample processing. Linearity, Limit of Detection (LOD) and precision studies were evaluated using the 3rd WHO standard. Clinical performance and correlation was evaluated across 279 specimens by using Abbott RealTime HBV assay as a method comparator.
Results:
The Alinity m HBV assay is compatible with EDTA and ACD plasma, serum, PPT, SST, and rapid-clot tubes. LOD by probit is 6.72 IU/mL for plasma and 9.62 IU/mL for serum. The assay is linear between ≤1 to ≥9 Log IU/mL for genotypes A-I in plasma and serum. A precision study demonstrated a within-laboratory SD of less than or equal to 0.21 Log from 1.3 to 9.4 Log IU/mL in plasma and serum. Carryover of 0.0% (95% CI: 0.0 to 1.0%) was demonstrated. An overall specificity of 100.0% (95% CI: 99.3 to 100.0%) was determined by testing 257 plasma and 253 serum specimens. A matrix equivalence study using negative and positive samples yielded an overall percent agreement between plasma and serum samples of 100.0% (95% CI: 95.1 to 100.0%) and Alinity m HBV quantitation demonstrated a slope of 0.97, intercept of 0.18, correlation coefficient (r) of 0.996, and mean bias of 0.04 Log IU/mL between plasma and serum samples. Method correlation to HBV by analyzing 279 specimens (139 plasma and 140 serum) from HBV infected patients (including genotypes A, B, C, D, E, F, G and H) demonstrated a correlation coefficient of 0.997.
Conclusions:
The Alinity m HBV assay utilizes a dual-probe assay design to deliver highly sensitive detection of diverse HBV genotypes and accurate quantitation across a wide dynamic range. This assay performance is further enhanced by rapid turnaround time (time-to-first-result of 115 minutes) and workflow flexibility of the Alinity m System.
Currently 3.5% (257 million) of people worldwide have chronic HBV infection. Chronic HBV infection can cause liver cirrhosis, hepatocellular carcinoma, and other diseases. Current guidelines recommend screening populations with HBV surface antigen and using a viral load assay to identify patients requiring therapy. The Alinity m HBV viral load assay was developed to achieve broad genotype inclusivity (A-I), high sensitivity, and a wide dynamic range. Here we evaluate key performance attibutes of the Alinity m HBV assay.
Methods:
The primer/probe target region was developed based on analysis of sequences from genotypes A-I in collaboration with Abbott’s Global Surveillance program. The Alinity m System utilizes magnetic microparticle sample preparation chemistry, unit-dose lyophilized amplification reagents, and ReadiFlex™ sample processing. Linearity, Limit of Detection (LOD) and precision studies were evaluated using the 3rd WHO standard. Clinical performance and correlation was evaluated across 279 specimens by using Abbott RealTime HBV assay as a method comparator.
Results:
The Alinity m HBV assay is compatible with EDTA and ACD plasma, serum, PPT, SST, and rapid-clot tubes. LOD by probit is 6.72 IU/mL for plasma and 9.62 IU/mL for serum. The assay is linear between ≤1 to ≥9 Log IU/mL for genotypes A-I in plasma and serum. A precision study demonstrated a within-laboratory SD of less than or equal to 0.21 Log from 1.3 to 9.4 Log IU/mL in plasma and serum. Carryover of 0.0% (95% CI: 0.0 to 1.0%) was demonstrated. An overall specificity of 100.0% (95% CI: 99.3 to 100.0%) was determined by testing 257 plasma and 253 serum specimens. A matrix equivalence study using negative and positive samples yielded an overall percent agreement between plasma and serum samples of 100.0% (95% CI: 95.1 to 100.0%) and Alinity m HBV quantitation demonstrated a slope of 0.97, intercept of 0.18, correlation coefficient (r) of 0.996, and mean bias of 0.04 Log IU/mL between plasma and serum samples. Method correlation to HBV by analyzing 279 specimens (139 plasma and 140 serum) from HBV infected patients (including genotypes A, B, C, D, E, F, G and H) demonstrated a correlation coefficient of 0.997.
Conclusions:
The Alinity m HBV assay utilizes a dual-probe assay design to deliver highly sensitive detection of diverse HBV genotypes and accurate quantitation across a wide dynamic range. This assay performance is further enhanced by rapid turnaround time (time-to-first-result of 115 minutes) and workflow flexibility of the Alinity m System.
Dr. Natalya Dzissyuk
Laboratory Specialist
Kazakh Scientific Center of Dermatology and Infectious Diseases MHRK
Prevalence of Transmissible HIV Resistance among PLHIV in Kazakhstan
Abstract
Background: The formation of HIV drug resistance to first-line antiretroviral drugs is a serious problem in achieving the effectiveness of antiretroviral treatment. HIV drug resistance to NRTIs and NNRTIs is detected every year in more than 50% of cases among PLHIV with virological failure of therapy. More often, the virus is resistant to NVP, EFV, 3TC, FTC (up to 90% among all cases of HIV resistance). The purpose of this study is to describe circulating viral subtypes and to assess the prevalence of primary HIV drug resistance among ART-naive patients diagnosed in the period from 2013-2017 years.
Materials and methods: 494 blood samples from HIV-positive patients from 10 regions of Kazakhstan were examined. RNA extraction and RT-PCR of the protease gene (1-99 codon) and parts of the reverse transcriptase gene (30-265 codon) were performed using the “AmpliSens-HIV-resist-seq” diagnostic kit (Russia). Sequencing of pro/rev genes was performed on the genetic analyzer AB3130 (Applied Biosystems). To obtain a consensus sequence and interpret the results of HIV drug resistance, Deona software (Russia) was used. The HIV-1 subtype was determined using the Comet HIV-1 program (http://comet.retrovirology.lu/) and phylogenetic analysis. Mutations were determined by using Surveillance Drug Resistance Mutation list (SDRM). The level of transmissible HIV drug resistance was determined using CPR (Calibrated Population Resistance) software (http://cpr.stanford.edu/cpr.cgi).
Results: Most of patients in the study group were male (53%); the median age of the individuals was 34.8 years (range, 30 - 37.8 years); the median number of CD4 cells - 476.2; by risk groups: people who inject drugs – 33.1 %; heterosexually infected – 63.1 %, MSM – 2.2%, and 4.4 % cases are unknown. Of the 494 patients included, 46.2% harbored the subtype A6, 49.0% - subtype AG (including Central Asian variant of HIV-1 CRF02_AG and recombinant forms between CRF02_AG and A6), 2.5% - subtype B, and other (CRF_03AB, CRF07_BC, CRF55_01B) – 2.3%. In each region, at least one case of infection with HIV strains was identified, in the genome of which there were mutations associated with drug resistance. In total, 18 people infected with drug-resistant strains of HIV-1 were identified, of which 5 patients (0.9%) had HIV drug resistance mutations to NRTIs (M41L - 2, L210W - 1, K219R- 2), 6 patients (1.4%) had mutations to NNRTIs (K103N+Y181C – 1; K103N - 3, K101E - 2), and 7 people (1.6%) had mutations to PIs (M46I - 6 and M46I+L90M - 1). Thus, the average level of transmissible HIV-1 resistance in the Republic of Kazakhstan was 4.1% (range, 1.9 % - 10%). The highest level of transmission of HIV was registered in the North Kazakhstan and Pavlodar regions (10% and 7.3%, respectively).
Conclusion: HIV-1 subtype А6 and recombinant form AG dominate in Kazakhstan. The transmission rate of HIV-1 drug resistant in Kazakhstan is low; however, its prevalence has increased in last years in the country. Due to the increase in treatment coverage, it is important to introduce National HIV drug resistance monitoring programs.
Materials and methods: 494 blood samples from HIV-positive patients from 10 regions of Kazakhstan were examined. RNA extraction and RT-PCR of the protease gene (1-99 codon) and parts of the reverse transcriptase gene (30-265 codon) were performed using the “AmpliSens-HIV-resist-seq” diagnostic kit (Russia). Sequencing of pro/rev genes was performed on the genetic analyzer AB3130 (Applied Biosystems). To obtain a consensus sequence and interpret the results of HIV drug resistance, Deona software (Russia) was used. The HIV-1 subtype was determined using the Comet HIV-1 program (http://comet.retrovirology.lu/) and phylogenetic analysis. Mutations were determined by using Surveillance Drug Resistance Mutation list (SDRM). The level of transmissible HIV drug resistance was determined using CPR (Calibrated Population Resistance) software (http://cpr.stanford.edu/cpr.cgi).
Results: Most of patients in the study group were male (53%); the median age of the individuals was 34.8 years (range, 30 - 37.8 years); the median number of CD4 cells - 476.2; by risk groups: people who inject drugs – 33.1 %; heterosexually infected – 63.1 %, MSM – 2.2%, and 4.4 % cases are unknown. Of the 494 patients included, 46.2% harbored the subtype A6, 49.0% - subtype AG (including Central Asian variant of HIV-1 CRF02_AG and recombinant forms between CRF02_AG and A6), 2.5% - subtype B, and other (CRF_03AB, CRF07_BC, CRF55_01B) – 2.3%. In each region, at least one case of infection with HIV strains was identified, in the genome of which there were mutations associated with drug resistance. In total, 18 people infected with drug-resistant strains of HIV-1 were identified, of which 5 patients (0.9%) had HIV drug resistance mutations to NRTIs (M41L - 2, L210W - 1, K219R- 2), 6 patients (1.4%) had mutations to NNRTIs (K103N+Y181C – 1; K103N - 3, K101E - 2), and 7 people (1.6%) had mutations to PIs (M46I - 6 and M46I+L90M - 1). Thus, the average level of transmissible HIV-1 resistance in the Republic of Kazakhstan was 4.1% (range, 1.9 % - 10%). The highest level of transmission of HIV was registered in the North Kazakhstan and Pavlodar regions (10% and 7.3%, respectively).
Conclusion: HIV-1 subtype А6 and recombinant form AG dominate in Kazakhstan. The transmission rate of HIV-1 drug resistant in Kazakhstan is low; however, its prevalence has increased in last years in the country. Due to the increase in treatment coverage, it is important to introduce National HIV drug resistance monitoring programs.
Dr. Robert Ehret
Molecular Biologist
MVZ mib AG
Integrating genotypic HIV tropism testing into the Vela Sentosa HIV genotyping and resistance assay
Abstract
Background:
Testing for CCR5-tropic virus is a requirement before starting a Maraviroc containing treatment as this CCR5 blocker can only act against CCR5-tropic HIV. Genotypic tropism testing by analysing the V3 loop sequence is the most common method used nowadays as phenotypic tropism testing is time-consuming and expensive and good guidelines and tools exist for interpretation of sequences. To detect and quantify minor non-CCR5-tropic populations the method of choice is to perform tropism testing using next generation sequencing. We established a method to integrateV3 loop analysis into the Vela Sentosa HIV next generation sequencing genotyping and resistance assay to analyse tropism together with Protease, Reverse Transkriptase and Integrase resistance.
Materials & methods
For optimized analyses in the geno2pheno coreceptor tool for NGS data (geno2pheno [454]) full length V3-loop sequences are necessary. We designed a nested PCR (1. round V3_6952f GCACAGTACAATGTACACATGG; V3_7357r CAGTAGAAAAATTCCCCTCCAC; 2. Round V3_7062f AATGCCAAAACCATAATAGTACA, V3_7316r TTCTGGGTCCCCTCCTGAG) with a final short PCR product of around 250 basepairs to avoid too much fragmentation within the V3-loop sequence. The PCR-product was spiked into left blank sample cavities after the PCR in the workflow of the Vela Sentosa HIV genotyping and resistance assay. The following steps (library prep, emulsion PCR, enrichment and sequencing) were performed within the standardized Vela workflow. 6636 full length envelope sequences were downloaded from Los Alamos database and used for mapping the NGS data and identifying sequences spanning the complete V3 loop. Using the geno2pheno [454] pre-processor sequences were prepared for upload and analysis with the geno2pheno [454] tool.
Results
Interpretation by geno2pheno [454] led to quality reads from 3000 – 11000 per sample with up to 1700 variants in a single sample. The predicted X4-tropic viruses at the false positive rate (FPR) cut-off of 3.75% varied between 0% and 99% interpreted as X4-tropic only or R5-tropic virus only. Results for proviral and plasma-viral preparations (for samples with viral loads below 200 c./mL or above 200 c./mL) led to comparably result quality.
Conclusions
Integrating a genotypic tropism test into the Vela Sentosa HIV genotyping and resistance assay showed excellent performance. The V3-loop sequences could be reliably detected and showed comparable results in geno2pheno 454 analysis compared to next generation sequencing using the illumina platform. The combined V3-loop sequencing with the Vela Sentosa HIV genotyping and resistance assay allows short turn-around times and completes the resistance analyses for HIV on the Vela platform.
Testing for CCR5-tropic virus is a requirement before starting a Maraviroc containing treatment as this CCR5 blocker can only act against CCR5-tropic HIV. Genotypic tropism testing by analysing the V3 loop sequence is the most common method used nowadays as phenotypic tropism testing is time-consuming and expensive and good guidelines and tools exist for interpretation of sequences. To detect and quantify minor non-CCR5-tropic populations the method of choice is to perform tropism testing using next generation sequencing. We established a method to integrateV3 loop analysis into the Vela Sentosa HIV next generation sequencing genotyping and resistance assay to analyse tropism together with Protease, Reverse Transkriptase and Integrase resistance.
Materials & methods
For optimized analyses in the geno2pheno coreceptor tool for NGS data (geno2pheno [454]) full length V3-loop sequences are necessary. We designed a nested PCR (1. round V3_6952f GCACAGTACAATGTACACATGG; V3_7357r CAGTAGAAAAATTCCCCTCCAC; 2. Round V3_7062f AATGCCAAAACCATAATAGTACA, V3_7316r TTCTGGGTCCCCTCCTGAG) with a final short PCR product of around 250 basepairs to avoid too much fragmentation within the V3-loop sequence. The PCR-product was spiked into left blank sample cavities after the PCR in the workflow of the Vela Sentosa HIV genotyping and resistance assay. The following steps (library prep, emulsion PCR, enrichment and sequencing) were performed within the standardized Vela workflow. 6636 full length envelope sequences were downloaded from Los Alamos database and used for mapping the NGS data and identifying sequences spanning the complete V3 loop. Using the geno2pheno [454] pre-processor sequences were prepared for upload and analysis with the geno2pheno [454] tool.
Results
Interpretation by geno2pheno [454] led to quality reads from 3000 – 11000 per sample with up to 1700 variants in a single sample. The predicted X4-tropic viruses at the false positive rate (FPR) cut-off of 3.75% varied between 0% and 99% interpreted as X4-tropic only or R5-tropic virus only. Results for proviral and plasma-viral preparations (for samples with viral loads below 200 c./mL or above 200 c./mL) led to comparably result quality.
Conclusions
Integrating a genotypic tropism test into the Vela Sentosa HIV genotyping and resistance assay showed excellent performance. The V3-loop sequences could be reliably detected and showed comparable results in geno2pheno 454 analysis compared to next generation sequencing using the illumina platform. The combined V3-loop sequencing with the Vela Sentosa HIV genotyping and resistance assay allows short turn-around times and completes the resistance analyses for HIV on the Vela platform.
Dr Jannik Fonager
Senior Scientist
Statens Serum Institut
Investigation of factors predicting being in a national transmission cluster and of late presentation with HIV-1 in Denmark, 2009-2017
Abstract
Introduction/Background: In Denmark, around 200 people are diagnosed with HIV-1 every year despite access to free highly efficient antiretroviral therapy (ART). Continued HIV-1 transmission in local networks as well as late presentation of HIV-1 are two major public health and clinical challenges. Sequence and epidemiological data from the Danish HIV-1 surveillance project (SERO) are used to monitor the spread of drug resistance and to identify risk groups and transmission clusters. Here we report on statistical investigations of correlates to being in a transmission cluster and being a late presenter.
Material & Methods: HIV-1 pol sequences from 1225 newly diagnosed (2009 to 2017) were aligned in MAFFT and phylogenetically analyzed in Mega 6.0 using the ML GTR method with 1000 bootstrap replicates. Clusters were identified using Cluster Picker (thresholds: bootstrap≥90, Genetic Distance≤4.5). Late presenters (LP) were patients with a CD4+ count<350 and/or AIDS defining illness. Statistical analyses were performed in R statistical software. The relation between risk factors and the odds of being in a cluster (“no-cluster”, “cluster size of 2”, and “cluster size of 3+) was investigated using partial ordinal logistic regression with infection method (MSM or heterosexual) as nominal effects. Risk factors for presentation status (LP versus non-LP) were investigated using standard logistic regression as well multi-level regression with cluster identity as a random effect.
Results: HIV-1 pol sequences from 1032 of the 1225 (84%) patients were eligible for analysis. Of these, 499 (48.4%) belonged to clusters. Odds ratio (OR) for being in a cluster were as follows: being of Danish ethnicity 2.97 (95% confidence interval (CI): 2.21–4.00); younger age (continuous variable): 1.03 (CI: 1.02–1.04); subtype B: 1.43 (CI: 1.05–0.96); non-LP: 1.46 (CI: 1.13–1.89); and MSM: 1.47 (CI: 1.05–2.04) for no-cluster vs a cluster size of 2, and 2.52 (CI: 1.73–3.66) for a cluster size of 2 versus 3+. No difference was found between active (new infection within the last 3 years) and non-active clusters, OR of 1.09 (CI: 0.83–1.42). Of the eligible patients, 499 (48.4%) were classified as LP. There was increased odds of being a LP among heterosexuals compared to MSM for individuals of non-Danish decent, but not for those of Danish ethnicity, with OR of 2.90 (CI: 1.79–4.71) and 1.42 (CI: 0.95–2.12) respectively. Also odds ratios increased more with age for those of Danish ethnicity compared to non-Danish ethnicity (OR: 1.03, CI: 1.00–1.06). The odds of being a LP was increased for non-clustered individuals (OR: 1.59, CI: 1.07-2.37), whereas cluster-activity played no role. Subtype was not associated with presentation status (OR: 0.88, CI: 0.62–1.23). A multi-level analysis did not significantly change the results.
Conclusions: Endemic HIV-1 transmission within clusters was primarily associated to subtype B infections among younger MSM of Danish ethnicity, who were diagnosed early after infection. LP were more commonly non-MSM, of non-Danish origin and not in a cluster. This knowledge can help to inform and design intervention strategies, such as groups targeted for PrEP and more frequent HIV-1 testing.
Material & Methods: HIV-1 pol sequences from 1225 newly diagnosed (2009 to 2017) were aligned in MAFFT and phylogenetically analyzed in Mega 6.0 using the ML GTR method with 1000 bootstrap replicates. Clusters were identified using Cluster Picker (thresholds: bootstrap≥90, Genetic Distance≤4.5). Late presenters (LP) were patients with a CD4+ count<350 and/or AIDS defining illness. Statistical analyses were performed in R statistical software. The relation between risk factors and the odds of being in a cluster (“no-cluster”, “cluster size of 2”, and “cluster size of 3+) was investigated using partial ordinal logistic regression with infection method (MSM or heterosexual) as nominal effects. Risk factors for presentation status (LP versus non-LP) were investigated using standard logistic regression as well multi-level regression with cluster identity as a random effect.
Results: HIV-1 pol sequences from 1032 of the 1225 (84%) patients were eligible for analysis. Of these, 499 (48.4%) belonged to clusters. Odds ratio (OR) for being in a cluster were as follows: being of Danish ethnicity 2.97 (95% confidence interval (CI): 2.21–4.00); younger age (continuous variable): 1.03 (CI: 1.02–1.04); subtype B: 1.43 (CI: 1.05–0.96); non-LP: 1.46 (CI: 1.13–1.89); and MSM: 1.47 (CI: 1.05–2.04) for no-cluster vs a cluster size of 2, and 2.52 (CI: 1.73–3.66) for a cluster size of 2 versus 3+. No difference was found between active (new infection within the last 3 years) and non-active clusters, OR of 1.09 (CI: 0.83–1.42). Of the eligible patients, 499 (48.4%) were classified as LP. There was increased odds of being a LP among heterosexuals compared to MSM for individuals of non-Danish decent, but not for those of Danish ethnicity, with OR of 2.90 (CI: 1.79–4.71) and 1.42 (CI: 0.95–2.12) respectively. Also odds ratios increased more with age for those of Danish ethnicity compared to non-Danish ethnicity (OR: 1.03, CI: 1.00–1.06). The odds of being a LP was increased for non-clustered individuals (OR: 1.59, CI: 1.07-2.37), whereas cluster-activity played no role. Subtype was not associated with presentation status (OR: 0.88, CI: 0.62–1.23). A multi-level analysis did not significantly change the results.
Conclusions: Endemic HIV-1 transmission within clusters was primarily associated to subtype B infections among younger MSM of Danish ethnicity, who were diagnosed early after infection. LP were more commonly non-MSM, of non-Danish origin and not in a cluster. This knowledge can help to inform and design intervention strategies, such as groups targeted for PrEP and more frequent HIV-1 testing.
Dr. Donia Gamoudi
Genitourinary Medicine Consultant
Mater Dei Hospital
Hepatitis HIV co-infected clinic: Is a specialised service worth implementing in medium sized HIV cohorts?
Abstract
Introduction
8% of our HIV cohort is co-infected with hepatitis C. Chronic infection with both HIV and Hepatitis C (HCV) has a potential adverse bidirectional impact. Widespread use of antiretroviral therapy (ART) has resulted in a dramatic decline in AIDS related mortality. With patients living longer, the complications associated with long term HCV infection has emerged as one of the most important clinical issues for people living with HIV (PLWH). Treatment barriers, polypharmacy, drug-drug interactions and liver toxicity are few of the common challenges encountered in this cohort. By integrating Hepatitis and HIV care pathways, patients are offered a more streamlined service with fewer clinic appointments, and real-time decisions can be made on drug switches and complications to improve the quality of care that co-infected patients receive. For these reasons, a specialist bimonthly co-infection clinic, managed jointly by a HIV specialist and a hepatologist was set up in November 2014.
Method
We analysed the data of the co infection clinic lists done between 2016 and 2018 for the reasons of referrals, treatment administered if any and outcome of the attendance.
Results
Out of the 95 co-infected cohort, 65 referrals were made between 2016 and 2018. 30 of these were for hepatitis C (46.1%).14 patients were seen in view of hepatitis B infection (21.5%), 10 for suspected non alcoholic fatty liver disease (NAFLD) (15.3%), 7 because of alcohol related liver disease (10.7%), 2 in view of portal hypertension secondary to drugs or portal vein thrombosis (3%) and 1 in view of autoimmune hepatitis (1.5%). 6% had more than 1 pathology identified.
83% of our Hepatitis C positive cohort successfully completed direct acting antiviral treatment (DAAs) and have reached SVR (12 weeks). The treatment regimens used were various. The most common prescribed DAA regimens were Sofosbuvir/ ledipasvir, elbasvir/grazoprevir and Ombitasvir/paritaprevir+ritonavir. 2 patients (3%) failed first line DAA and have been retreated with second line therapy. They have both successfully eradicated Hepatitis C.
The remaining untreated co-infected patients have either been declining treatment, not engaging with our services or are being investigated for other complex medical issues, hence putting the hepatitis C treatment on hold.
Conclusion
Now that hepatitis C is curable with a relatively short course of DAA with minimal to none side effects, getting our co-infected patients engaged in our services is more important than ever before. A Joint HIV-Hepatitis clinic allows patients to receive a comprehensive and consistent approach to evaluation for treatment, support during treatment and careful monitoring and management of treatment response and complications in a timely and efficient manner. This type of streamlined service not only improves the quality of care but also the patient experience.
8% of our HIV cohort is co-infected with hepatitis C. Chronic infection with both HIV and Hepatitis C (HCV) has a potential adverse bidirectional impact. Widespread use of antiretroviral therapy (ART) has resulted in a dramatic decline in AIDS related mortality. With patients living longer, the complications associated with long term HCV infection has emerged as one of the most important clinical issues for people living with HIV (PLWH). Treatment barriers, polypharmacy, drug-drug interactions and liver toxicity are few of the common challenges encountered in this cohort. By integrating Hepatitis and HIV care pathways, patients are offered a more streamlined service with fewer clinic appointments, and real-time decisions can be made on drug switches and complications to improve the quality of care that co-infected patients receive. For these reasons, a specialist bimonthly co-infection clinic, managed jointly by a HIV specialist and a hepatologist was set up in November 2014.
Method
We analysed the data of the co infection clinic lists done between 2016 and 2018 for the reasons of referrals, treatment administered if any and outcome of the attendance.
Results
Out of the 95 co-infected cohort, 65 referrals were made between 2016 and 2018. 30 of these were for hepatitis C (46.1%).14 patients were seen in view of hepatitis B infection (21.5%), 10 for suspected non alcoholic fatty liver disease (NAFLD) (15.3%), 7 because of alcohol related liver disease (10.7%), 2 in view of portal hypertension secondary to drugs or portal vein thrombosis (3%) and 1 in view of autoimmune hepatitis (1.5%). 6% had more than 1 pathology identified.
83% of our Hepatitis C positive cohort successfully completed direct acting antiviral treatment (DAAs) and have reached SVR (12 weeks). The treatment regimens used were various. The most common prescribed DAA regimens were Sofosbuvir/ ledipasvir, elbasvir/grazoprevir and Ombitasvir/paritaprevir+ritonavir. 2 patients (3%) failed first line DAA and have been retreated with second line therapy. They have both successfully eradicated Hepatitis C.
The remaining untreated co-infected patients have either been declining treatment, not engaging with our services or are being investigated for other complex medical issues, hence putting the hepatitis C treatment on hold.
Conclusion
Now that hepatitis C is curable with a relatively short course of DAA with minimal to none side effects, getting our co-infected patients engaged in our services is more important than ever before. A Joint HIV-Hepatitis clinic allows patients to receive a comprehensive and consistent approach to evaluation for treatment, support during treatment and careful monitoring and management of treatment response and complications in a timely and efficient manner. This type of streamlined service not only improves the quality of care but also the patient experience.
Dr. Federico García
Head Of Clinical Microbiology
University Hospital San Cecilio
Baseline resistance to Doravirine and genetic barrier of Doravirine containing regimens in Spain, 2018.
Abstract
Background
The Spanish cohort of naïve HIV infected individuals (CoRIS) offers relevant information about the current epidemiological profile of HIV infection, and is an excellent scenario to characterise the prevalence of TDR over time in Spain. We have previously characterized TDR in RT/Pro/Integrase in CoRIS throughout the period 2007-2017. Here we report the results on the prevalence of Doravirine associated mutations, clinical resistance to this drug and other NNRTIs, and the genetic barrier of Doravirine containing regimens in Spain during 2018.
Patients & Methods
To investigate the prevalence of NNRTI transmitted drug resistance, we used the WHO-2009 list with the following additional mutations E138A/G/K/Q/R, V108I, V179L, G190Q, H221Y, F227C/L/V, M230IDR, L234I, P236L, Y318F. The prevalence of Doravirine associated mutations, as described by Soulie et al. 2018 (doi:10.1093/jac/dky464) was evaluated. Clinically relevant TDR were investigated using the latest versions of ANRS and RIS Algorithms. Resistance to tenofovir (TDF) and 3TC, the drugs that will be included in a Doravirine-based STR were also investigated.
Results
Our cohort included 617 patients. Overall, NNRTI mutations were detected in 61 patients (9.9%). The prevalence of NNRTI associated mutations was: K101E (n=4, 0.6%), K101P (n=1, 0.2%), K103N (n=20, 3.2%), K103S (n=2, 0.3%), V106M (n=1, 0.2%), V108I (n=3, 0.5%), E138A (n=23, 3.7%), E138G (n=5, 0.8%), E138K (n=3, 0.5%), Y188C (n=2, 0.3%), Y188L (n=1, 0.2%), G190A (n=3, 0.5%), H221Y (n=1, 0.2%), F227L (n=1, 0.2%) and Y318F (n=1, 0.2%). Doravirine associated mutations are highlighted in bold and were detected in 5 patients, making a prevalence of 0.8%. Clinically relevant resistance to Doravirine was 0.3%, while it was 5.3% to Efavirenz, and 8.4% to Rilpivirine. In the cohort, for the first line NNRTIs TDF and 3TC clinically relevant resistance was in both cases 0.3%. No patient shared resistance to TDF, 3TC and/or DOR while one patient shared resistance to DOR and 3TC (K70G, M184V, K103N, V106M, V179T, Y318F).
Conclusions
Transmitted Drug Resistance to Doravirine, in contrast to Efavirenz and Rilpivirine, is very low in 2018 in Spain. Less than 0.5% of the newly diagnosed patients in Spain will be resistant to at least one of the drugs in first line Doravirine containing regimens.
The Spanish cohort of naïve HIV infected individuals (CoRIS) offers relevant information about the current epidemiological profile of HIV infection, and is an excellent scenario to characterise the prevalence of TDR over time in Spain. We have previously characterized TDR in RT/Pro/Integrase in CoRIS throughout the period 2007-2017. Here we report the results on the prevalence of Doravirine associated mutations, clinical resistance to this drug and other NNRTIs, and the genetic barrier of Doravirine containing regimens in Spain during 2018.
Patients & Methods
To investigate the prevalence of NNRTI transmitted drug resistance, we used the WHO-2009 list with the following additional mutations E138A/G/K/Q/R, V108I, V179L, G190Q, H221Y, F227C/L/V, M230IDR, L234I, P236L, Y318F. The prevalence of Doravirine associated mutations, as described by Soulie et al. 2018 (doi:10.1093/jac/dky464) was evaluated. Clinically relevant TDR were investigated using the latest versions of ANRS and RIS Algorithms. Resistance to tenofovir (TDF) and 3TC, the drugs that will be included in a Doravirine-based STR were also investigated.
Results
Our cohort included 617 patients. Overall, NNRTI mutations were detected in 61 patients (9.9%). The prevalence of NNRTI associated mutations was: K101E (n=4, 0.6%), K101P (n=1, 0.2%), K103N (n=20, 3.2%), K103S (n=2, 0.3%), V106M (n=1, 0.2%), V108I (n=3, 0.5%), E138A (n=23, 3.7%), E138G (n=5, 0.8%), E138K (n=3, 0.5%), Y188C (n=2, 0.3%), Y188L (n=1, 0.2%), G190A (n=3, 0.5%), H221Y (n=1, 0.2%), F227L (n=1, 0.2%) and Y318F (n=1, 0.2%). Doravirine associated mutations are highlighted in bold and were detected in 5 patients, making a prevalence of 0.8%. Clinically relevant resistance to Doravirine was 0.3%, while it was 5.3% to Efavirenz, and 8.4% to Rilpivirine. In the cohort, for the first line NNRTIs TDF and 3TC clinically relevant resistance was in both cases 0.3%. No patient shared resistance to TDF, 3TC and/or DOR while one patient shared resistance to DOR and 3TC (K70G, M184V, K103N, V106M, V179T, Y318F).
Conclusions
Transmitted Drug Resistance to Doravirine, in contrast to Efavirenz and Rilpivirine, is very low in 2018 in Spain. Less than 0.5% of the newly diagnosed patients in Spain will be resistant to at least one of the drugs in first line Doravirine containing regimens.
Dr. Evgeniya Kazakova
Head of Lab
Research Institute Of Virology
HIV drug resistance and distribution of genotypes among ART-naïve patients in Uzbekistan.
Abstract
Background. In 2018, to study the prevalence of pretreatment HIV drug resistance, 180 blood samples were collected among adult naïve-patients in Uzbekistan for genotyping HIV and evaluating HIV drug resistance. The results were compared with the results of a similar study conducted in 2015. Patients of both studies are proportionally collected from 15 clinics located throughout the country;
Materials & Methods. In total, 367 sequences HIV-naïve patients were obtained (158 of them are from samples of 2018, 209 from 2015). Then a phylogenetic analysis of the HIV subtypes was performed. SDRMs were determined using the Calibrated Population Resistance Tool.
Results. The overall prevalence of SDRM was the same in 2015 and in 2018 and was 3.8%. The structure of the SDRM also has not changed: the non-polymorfic K103N mutation is most common for NNRT and reduced susceptibility to NVP and EFV for 2.5% patients; M41L (TAMs), K65R (It reduces TDF, ABC and ddI susceptibility), M184I (are selected by 3TC/FTC and reduce susceptibility to these drugs >100-fold) mutations observed for NRTI in single cases; M46L mutation detected for PI(M46I/L are associated with reduced susceptibility to ATV, FPV, IDV, LPV and NFV ) in 1% cases. But the distribution of genotypes has changed. In 2015, the HIV-1 subtypes frequency found in the studied population were 55.0% of CRF_02AG, 37.3% subtype A6, 1.4% subtype B, 0.5% subtype C and 5.8% of recombinant forms. In 2018 the subtype frequency were 48.7% of A6, 38.6% CRF_02AG, 1.3% subtype C, 0.6% subtype G, 0.6% subtype B and 10.2% of recombinant forms.
Conclusions. Genotype CRF_02AG for a long time was the most common in Uzbekistan. The increase in the occurrence of A6 genotype compared to CRF_02AG can be associated with an increase of population mobility, since A6 genotype is the most common in neighboring countries. The prevalence of resistance mutations found in this research is considered to be low; therefore, performing genotyping tests before initiating antiretroviral therapy cannot be yet recommended.
Materials & Methods. In total, 367 sequences HIV-naïve patients were obtained (158 of them are from samples of 2018, 209 from 2015). Then a phylogenetic analysis of the HIV subtypes was performed. SDRMs were determined using the Calibrated Population Resistance Tool.
Results. The overall prevalence of SDRM was the same in 2015 and in 2018 and was 3.8%. The structure of the SDRM also has not changed: the non-polymorfic K103N mutation is most common for NNRT and reduced susceptibility to NVP and EFV for 2.5% patients; M41L (TAMs), K65R (It reduces TDF, ABC and ddI susceptibility), M184I (are selected by 3TC/FTC and reduce susceptibility to these drugs >100-fold) mutations observed for NRTI in single cases; M46L mutation detected for PI(M46I/L are associated with reduced susceptibility to ATV, FPV, IDV, LPV and NFV ) in 1% cases. But the distribution of genotypes has changed. In 2015, the HIV-1 subtypes frequency found in the studied population were 55.0% of CRF_02AG, 37.3% subtype A6, 1.4% subtype B, 0.5% subtype C and 5.8% of recombinant forms. In 2018 the subtype frequency were 48.7% of A6, 38.6% CRF_02AG, 1.3% subtype C, 0.6% subtype G, 0.6% subtype B and 10.2% of recombinant forms.
Conclusions. Genotype CRF_02AG for a long time was the most common in Uzbekistan. The increase in the occurrence of A6 genotype compared to CRF_02AG can be associated with an increase of population mobility, since A6 genotype is the most common in neighboring countries. The prevalence of resistance mutations found in this research is considered to be low; therefore, performing genotyping tests before initiating antiretroviral therapy cannot be yet recommended.
Dr. Alina Kirichenko
senior scientific researcher
Central Research Institute of Epidemiology
Prevalence and structure of HIV-1 drug resistance to integrase strand‑transfer inhibitors among naïve patients and treatment-experienced patients in Russian Federation
Abstract
Background. Achieving the goal “90-90-90” led to a significant increase the number of HIV-1 infected patients on ART in Russia. ART roll-out has improved outcomes but has resulted in increasing acquired and transmitted resistances to the drugs used.
INSTIs are the newest class of antiretroviral drugs to be approved for treatment. In Russia only two drugs have been registered (RAL and DTG) and since 2017 they are part of the first-line therapy.
Thus, to assess the prediction of the effectiveness of the use of INSTI in Russia, it was of interest to analyze the prevalence and structure of resistance mutations in the integrase gene of HIV-1 among: treatment-naïve patients, patients with ineffective therapy, which not included INSTIs, and patients with ineffective therapy, which included INSTIs.
Materials and methods. We analyzed 434 integrase sequences from HIV-infected patients, collected between 2008 and 2018: 227 treatment-naïve patients, 185 patients with virological failure of therapy without INSTI and 22 patients, whom experienced ineffective therapy, which included RAL (median duration of taking was 1,1 years). Integrase sequences were obtained by AmpliSens® HIV-Resist-Seq kit. Viral subtype and drug resistance were determined using the HIVdb Program v.8.4.
Results. HIV-1 subtype A6 was the most frequent clade (86.6%), subtype B was detected for 31 (7.1%) viruses, subtype G for 3 (0.7%) viruses and CRF02_AG (3.9%), CRF63_02A1 (1.6%). Mutations associated with DR to INSTI were detected in 5 (2.2%) treatment-naïve patients. In 5 patients were found mutation to EVG, in 4 to RAL, in 2 to DTG and to BIC. Four patients had major mutations: Q146P (0.9%), Y143C (0.4%), Q148H (0.4%), and 5 patients had accessory mutations: G163R (1.3%) and S153Y/F (0.9%).
Four samples (2.2%) from treated patients with ineffective therapy had resistance mutations: to EVG and RAL, in 1 to DTG and BIC. The only major substitution detected in this samples was R263K (0.5%) and 2 accessory mutations in 3 patients: E157Q (1.1%), T97A (0.5%).
It is important to note the highly polymorphic accessory mutation L74I, which was observed in 353/412 patients without experience INSTI. Although the presence of an L74I mutation alone is not associated with significantly reduced drug susceptibility, in combination with other major drug resistance mutations it could reduce viral susceptibility to INSTIs.
Among 22 raltegravir-treated patients resistance mutations were found in 13 (59.1%) of them. In 13 patients were found mutations associated with DR to EVG and to RAL, in 7 patients to DTG and to BIC. The most commonly selected INSTI major mutations were Y143C/R (40.9%) and N155H (13.6%). The most frequent INSTI accessory resistance mutations were T97A (31.8%), G163R (13.6%).
Conclusions. Our results demonstrate a low rate of DR to INSTIs in Russia among patients without experience INSTI. It proves the efficiency of INSTI-based drug regimens application in treatment-naïve and treatment-experienced patients even with virological failure.
For RAL-treatment patients was obtained high rate of resistance prevalence to this drug. However, DTG has high-genetic barrier and has low degree of cross-resistance with RAL, consequently will effectively inhibit viral variants which resistant to RAL.
INSTIs are the newest class of antiretroviral drugs to be approved for treatment. In Russia only two drugs have been registered (RAL and DTG) and since 2017 they are part of the first-line therapy.
Thus, to assess the prediction of the effectiveness of the use of INSTI in Russia, it was of interest to analyze the prevalence and structure of resistance mutations in the integrase gene of HIV-1 among: treatment-naïve patients, patients with ineffective therapy, which not included INSTIs, and patients with ineffective therapy, which included INSTIs.
Materials and methods. We analyzed 434 integrase sequences from HIV-infected patients, collected between 2008 and 2018: 227 treatment-naïve patients, 185 patients with virological failure of therapy without INSTI and 22 patients, whom experienced ineffective therapy, which included RAL (median duration of taking was 1,1 years). Integrase sequences were obtained by AmpliSens® HIV-Resist-Seq kit. Viral subtype and drug resistance were determined using the HIVdb Program v.8.4.
Results. HIV-1 subtype A6 was the most frequent clade (86.6%), subtype B was detected for 31 (7.1%) viruses, subtype G for 3 (0.7%) viruses and CRF02_AG (3.9%), CRF63_02A1 (1.6%). Mutations associated with DR to INSTI were detected in 5 (2.2%) treatment-naïve patients. In 5 patients were found mutation to EVG, in 4 to RAL, in 2 to DTG and to BIC. Four patients had major mutations: Q146P (0.9%), Y143C (0.4%), Q148H (0.4%), and 5 patients had accessory mutations: G163R (1.3%) and S153Y/F (0.9%).
Four samples (2.2%) from treated patients with ineffective therapy had resistance mutations: to EVG and RAL, in 1 to DTG and BIC. The only major substitution detected in this samples was R263K (0.5%) and 2 accessory mutations in 3 patients: E157Q (1.1%), T97A (0.5%).
It is important to note the highly polymorphic accessory mutation L74I, which was observed in 353/412 patients without experience INSTI. Although the presence of an L74I mutation alone is not associated with significantly reduced drug susceptibility, in combination with other major drug resistance mutations it could reduce viral susceptibility to INSTIs.
Among 22 raltegravir-treated patients resistance mutations were found in 13 (59.1%) of them. In 13 patients were found mutations associated with DR to EVG and to RAL, in 7 patients to DTG and to BIC. The most commonly selected INSTI major mutations were Y143C/R (40.9%) and N155H (13.6%). The most frequent INSTI accessory resistance mutations were T97A (31.8%), G163R (13.6%).
Conclusions. Our results demonstrate a low rate of DR to INSTIs in Russia among patients without experience INSTI. It proves the efficiency of INSTI-based drug regimens application in treatment-naïve and treatment-experienced patients even with virological failure.
For RAL-treatment patients was obtained high rate of resistance prevalence to this drug. However, DTG has high-genetic barrier and has low degree of cross-resistance with RAL, consequently will effectively inhibit viral variants which resistant to RAL.
Prof. Leondios Kostrikis
Professor
University of Cyprus
A touchdown PCR assay of HIV-1 pol for a comprehensive genotypic drug resistance analysis of patients infected with group M HIV-1 strains
Abstract
Background: PCR assays for the genotypic drug resistance analysis of all antiretroviral agents (reverse transcriptase, protease and integrase inhibitors) are increasingly in demand. This study was focused on the development of an assay for the PCR amplification of the entire HIV-1 pol region of major circulating group M HIV-1 strains in Europe. Nucleic acid amplification was followed by DNA sequencing, to enable the potential discovery of mutations associated with drug-resistance. Furthermore, phylogenetic analysis was performed on the sequenced samples, for the identification of active transmission clusters to facilitate a potential prompt public health response to those clusters.
Materials and Methods: The touchdown RT-PCR protocol used in this study was developed to process viral RNA, extracted from the plasma of blood samples of consenting HIV-1-infected patients in Cyprus (2017-2018). For the amplification of the pol region, touchdown PCR was utilized for both RT-PCR and the nested PCR that followed, with primers designed to have a broad coverage of major group M HIV-1 subtypes and recombinant strains. The temperature of the annealing phase in each PCR, was selected to be about 10°C higher than the calculated optimal primer melting temperature, with a ΔΤ=-1 °C in each subsequent cycle until the optimal temperature is reached followed by a final amplification step at the optimal temperature. Successful PCR amplicons were then sequenced by the Sanger method, followed by the inference of genotypic drug resistance through the Stanford drug resistance tool. Phylogenetic analyses were then performed through MEGAX and maximum likelihood trees were generated. Transmission clusters were then identified through Cluster Picker.
Results: A PCR assay that successfully amplifies the entire HIV-1 pol region (3,258 nucleotides long) of major group M HIV-1 subtypes and recombinant strains was developed and evaluated by group M strains isolated from HIV-1-infected patients in Cyprus. Crucial to the design of the assay was the higher than optimal starting temperature of the initial amplification of touchdown PCR, which conferred increased specificity by ensuring that only perfectly matched primers bound to the templates. Since the assay was created to be indiscriminate of subtype, it had to accommodate variability, which was achieved by designing primers that cover a broad range of HIV-1 subtypes. Through this assay, a number of subtypes were identified such as A1, A2 and B, but also common circulating recombinant forms such as CRF02_AG and CRF04_CPX. Furthermore, through phylogenetic analysis, the identification of transmission clusters growing in near real-time was achieved, and another cluster consisting of an uncommon recombinant (Rec_B, A1, G) was also revealed.
Conclusion: The developed touchdown PCR assay reliably amplifies the entire pol region of a broad array of group M HIV-1 subtypes and recombinant strains; and the drug resistance analysis of protease, reverse transcriptase and integrase inhibitors is achieved as a result of a singular PCR assay and sequencing. Furthermore, the follow up phylogenetic analysis facilitates the identification of transmission clusters among the sequenced data, which in turn enables the option for a prompt public health intervention.
Materials and Methods: The touchdown RT-PCR protocol used in this study was developed to process viral RNA, extracted from the plasma of blood samples of consenting HIV-1-infected patients in Cyprus (2017-2018). For the amplification of the pol region, touchdown PCR was utilized for both RT-PCR and the nested PCR that followed, with primers designed to have a broad coverage of major group M HIV-1 subtypes and recombinant strains. The temperature of the annealing phase in each PCR, was selected to be about 10°C higher than the calculated optimal primer melting temperature, with a ΔΤ=-1 °C in each subsequent cycle until the optimal temperature is reached followed by a final amplification step at the optimal temperature. Successful PCR amplicons were then sequenced by the Sanger method, followed by the inference of genotypic drug resistance through the Stanford drug resistance tool. Phylogenetic analyses were then performed through MEGAX and maximum likelihood trees were generated. Transmission clusters were then identified through Cluster Picker.
Results: A PCR assay that successfully amplifies the entire HIV-1 pol region (3,258 nucleotides long) of major group M HIV-1 subtypes and recombinant strains was developed and evaluated by group M strains isolated from HIV-1-infected patients in Cyprus. Crucial to the design of the assay was the higher than optimal starting temperature of the initial amplification of touchdown PCR, which conferred increased specificity by ensuring that only perfectly matched primers bound to the templates. Since the assay was created to be indiscriminate of subtype, it had to accommodate variability, which was achieved by designing primers that cover a broad range of HIV-1 subtypes. Through this assay, a number of subtypes were identified such as A1, A2 and B, but also common circulating recombinant forms such as CRF02_AG and CRF04_CPX. Furthermore, through phylogenetic analysis, the identification of transmission clusters growing in near real-time was achieved, and another cluster consisting of an uncommon recombinant (Rec_B, A1, G) was also revealed.
Conclusion: The developed touchdown PCR assay reliably amplifies the entire pol region of a broad array of group M HIV-1 subtypes and recombinant strains; and the drug resistance analysis of protease, reverse transcriptase and integrase inhibitors is achieved as a result of a singular PCR assay and sequencing. Furthermore, the follow up phylogenetic analysis facilitates the identification of transmission clusters among the sequenced data, which in turn enables the option for a prompt public health intervention.
Professor Ivana Maida
Associate Professor
University Of Sassari
Causes of death in HCV positive patients successfully treated with DAAs
Abstract
Background and Aims:
HCV infection can lead to the development of complications such as cirrhosis and hepatocellular carcinoma (HCC). Currently, direct-acting antiviral drugs (DAAs) are the main treatment for HCV + patients, including cirrhotic patients, allowing the achievement of sustained virological response (SVR) in 90-95% of cases. Actually, there is unclear association between treatment with DAAs and risk of increased occurrence of HCC. No information is available on the causes of mortality of HCV + patients after treatment with DAAs.
Method:
The study was designed to evaluate all the causes of mortality in HCV + patients undergoing DAAs at AOU of Sassari, between January 2015 and September 2017.
Patients were evaluated in an observational manner and subjected to various controls: at baseline, during therapy and during follow-up. Liver fibrosis was measured by elastometry with FibroScan before and after treatment.
Results:
Out of a total of 355 patients (206 M/149 F), mean age 49.5 ± 4.95, with HCV-related chronic hepatitis, DAAs therapy induced an SVR in 94% of cases.
Of these, 38 had a basal stage of fibrosis F0/F1, 31 stage F2, 88 stage F3 and 198 stage F4.
During the first 52 weeks of follow-up 12 deaths were detected (3.38%, 10 M/2 F): 4 related to HCC (3 relapses, 1 de novo) and its complications, while the remaining 8 were due to other causes (lymphoma, cerebral hemorrhage, prostate adenocarcinoma, breast cancer, lung neoplasm, suicide, femoral fracture complications, cachexia). Among the deceased patients, 10 had a F4, 1 stage F2 and 1 stage F0F1 stage.
During the observation period, HCC was detected in 9 (2.54%, 95% CI: 0.903-4.176) patients: 4 cases occurred in patients (57%, 95% CI: 20.33-93.67) with previous HCC and in 5 patients (1.44%, 95% CI: 0.188-2.692) HCC presented itself de novo.
Conclusion:
Numerous studies have shown that the majority of HCV + patients who underwent antiviral treatment with DAAs obtained SVR with virus eradication. No association was found between treatment with DAAs and recurrence/occurrence of HCC, although patients previously treated for HCC have a higher risk of short-term tumor recurrence. All this suggests that close follow-up in cirrhotic patients remains mandatory during and after antiviral therapy.
Our results confirm that there is no greater risk of de novo hepatic neoplasia after antiviral therapy with DAAs. The initial condition of cirrhosis in the eradicated patients does not represent the cause of greater mortality in the studied population.
HCV infection can lead to the development of complications such as cirrhosis and hepatocellular carcinoma (HCC). Currently, direct-acting antiviral drugs (DAAs) are the main treatment for HCV + patients, including cirrhotic patients, allowing the achievement of sustained virological response (SVR) in 90-95% of cases. Actually, there is unclear association between treatment with DAAs and risk of increased occurrence of HCC. No information is available on the causes of mortality of HCV + patients after treatment with DAAs.
Method:
The study was designed to evaluate all the causes of mortality in HCV + patients undergoing DAAs at AOU of Sassari, between January 2015 and September 2017.
Patients were evaluated in an observational manner and subjected to various controls: at baseline, during therapy and during follow-up. Liver fibrosis was measured by elastometry with FibroScan before and after treatment.
Results:
Out of a total of 355 patients (206 M/149 F), mean age 49.5 ± 4.95, with HCV-related chronic hepatitis, DAAs therapy induced an SVR in 94% of cases.
Of these, 38 had a basal stage of fibrosis F0/F1, 31 stage F2, 88 stage F3 and 198 stage F4.
During the first 52 weeks of follow-up 12 deaths were detected (3.38%, 10 M/2 F): 4 related to HCC (3 relapses, 1 de novo) and its complications, while the remaining 8 were due to other causes (lymphoma, cerebral hemorrhage, prostate adenocarcinoma, breast cancer, lung neoplasm, suicide, femoral fracture complications, cachexia). Among the deceased patients, 10 had a F4, 1 stage F2 and 1 stage F0F1 stage.
During the observation period, HCC was detected in 9 (2.54%, 95% CI: 0.903-4.176) patients: 4 cases occurred in patients (57%, 95% CI: 20.33-93.67) with previous HCC and in 5 patients (1.44%, 95% CI: 0.188-2.692) HCC presented itself de novo.
Conclusion:
Numerous studies have shown that the majority of HCV + patients who underwent antiviral treatment with DAAs obtained SVR with virus eradication. No association was found between treatment with DAAs and recurrence/occurrence of HCC, although patients previously treated for HCC have a higher risk of short-term tumor recurrence. All this suggests that close follow-up in cirrhotic patients remains mandatory during and after antiviral therapy.
Our results confirm that there is no greater risk of de novo hepatic neoplasia after antiviral therapy with DAAs. The initial condition of cirrhosis in the eradicated patients does not represent the cause of greater mortality in the studied population.
Dr. Natallia Matsiyeuskaya
Head Of Department Of Infectious Diseases
Grodno State Medical University
Expression of HLR-DR on T-lymphocytes, content of CD4+CD25+T-regulatory cells and CD4+CCR5+T-cells in HIV-infected patients, depending on the presence of AIDS and the virus tropism
Abstract
Background. Switching tropism of HIV in the course of HIV infection is considered as an unfavorable factor during the course of the disease. It is possible to assume the presence of various immunological mechanisms for the formation of immunosuppression at different tropism of HIV.
Aim of study: to present the expression of HLR-DR like marker of immunity activation on blood T-lymphocytes, the content of CD4+CD25+ T-regulatory cells and CD4+CCR5+T-cells in HIV-infected patients depending on the presence of AIDS and the nature of the virus tropism.
Material and methods. Two groups of HIV-infected patients were included in the study: group 1 - 34 patients infected with the R5-tropic virus (mean age 34.1 ± 5.9 years old, males - 14/41.2%), among them AIDS (the 4th clinical the stage of HIV infection by WHO classification (2006) and/or CD4+T cells less than 200 cells/µl) was in 10 patients. Group 2 - 19 patients (mean age - 33.4 ± 6.3, males - 10/52.6%) infected with non-R5-tropic virus, among them AIDS was identified in 7 cases.
The cell immunophenotype was determined by Flow cytometry (FACS Calibur). Monoclonal antibodies produced by ExBio, Czech Republic and BD, USA were used.
The HIV-1 tropism for CCR5 and CXCR4 coreceptors was determined by a genotypic method based on the sequencing of the V3 loop of gp120 of the HIV env gene. The nucleotide sequences were edited and the consensus nucleotide sequence was obtained using the DEONA software (MediTi Group, Russia). Analysis of the nucleotide sequence was carried out on the website http://www.geno2pheno.org/ of the Max Planck Institute for Computer Science (Max Planck Institut Informatik, Germany). The FPR (False Positive Rate) was assumed to be 20%.
Results. In patients infected with non R5-tropic HIV with the presence of AIDS compared with patients without AIDS an increase the percentage of HLA-DR+CD3+T-lymphocytes: 36.08 (33.9-50.6) and 29.9 (17.5-31.3), p<0.05, respectively, and number of HLA-DR+T-helpers (cells/μl): 37.8 (26.2-51.5) and 62.81 (51.9-84.6), p<0.05, respectively, an increase in the intensity of HLA-DR expression by T-helpers (conventional units): 116.2 (108.4-132.6) and 76.7 (57.2-83.2), p<0.05, respectively, expression of HLA-DR by CD3+CD8+lymphocytes (%): 62.79 (57-70.3) and 46,46 (36,7-56,6), p<0.05, respectively was found. Also, in patients of the 2nd group with AIDS in comparison with patients without AIDS a decrease in the content of CD4+CD25+T-regulatory cells (cells/μl): 8.6 (4.76-22.1) and 23.8 (13.9-41,7), p<0.05, respectively, a decrease in the content of CD4+CCR5+T-helpers (cells/μl): 18.58 (8.52-32.6) and 55.67 (43.65-85.43), p <0.05, respectively was found.
In patients infected with R5-tropic HIV, there were no significant differences in the content of these cells depending on AIDS presence.
Conclusions. In patients with non R5-tropic HIV, the formation of AIDS, unlike patients with R5-tropic HIV, showed a pronounced activation of T-cell immunity, a decrease in the content of CD4+CD25+T-regulatory cells and CD4+CCR5+T-cells, which indicates different immunological mechanisms of AIDS formation at HIV-infection with different virus tropism.
Aim of study: to present the expression of HLR-DR like marker of immunity activation on blood T-lymphocytes, the content of CD4+CD25+ T-regulatory cells and CD4+CCR5+T-cells in HIV-infected patients depending on the presence of AIDS and the nature of the virus tropism.
Material and methods. Two groups of HIV-infected patients were included in the study: group 1 - 34 patients infected with the R5-tropic virus (mean age 34.1 ± 5.9 years old, males - 14/41.2%), among them AIDS (the 4th clinical the stage of HIV infection by WHO classification (2006) and/or CD4+T cells less than 200 cells/µl) was in 10 patients. Group 2 - 19 patients (mean age - 33.4 ± 6.3, males - 10/52.6%) infected with non-R5-tropic virus, among them AIDS was identified in 7 cases.
The cell immunophenotype was determined by Flow cytometry (FACS Calibur). Monoclonal antibodies produced by ExBio, Czech Republic and BD, USA were used.
The HIV-1 tropism for CCR5 and CXCR4 coreceptors was determined by a genotypic method based on the sequencing of the V3 loop of gp120 of the HIV env gene. The nucleotide sequences were edited and the consensus nucleotide sequence was obtained using the DEONA software (MediTi Group, Russia). Analysis of the nucleotide sequence was carried out on the website http://www.geno2pheno.org/ of the Max Planck Institute for Computer Science (Max Planck Institut Informatik, Germany). The FPR (False Positive Rate) was assumed to be 20%.
Results. In patients infected with non R5-tropic HIV with the presence of AIDS compared with patients without AIDS an increase the percentage of HLA-DR+CD3+T-lymphocytes: 36.08 (33.9-50.6) and 29.9 (17.5-31.3), p<0.05, respectively, and number of HLA-DR+T-helpers (cells/μl): 37.8 (26.2-51.5) and 62.81 (51.9-84.6), p<0.05, respectively, an increase in the intensity of HLA-DR expression by T-helpers (conventional units): 116.2 (108.4-132.6) and 76.7 (57.2-83.2), p<0.05, respectively, expression of HLA-DR by CD3+CD8+lymphocytes (%): 62.79 (57-70.3) and 46,46 (36,7-56,6), p<0.05, respectively was found. Also, in patients of the 2nd group with AIDS in comparison with patients without AIDS a decrease in the content of CD4+CD25+T-regulatory cells (cells/μl): 8.6 (4.76-22.1) and 23.8 (13.9-41,7), p<0.05, respectively, a decrease in the content of CD4+CCR5+T-helpers (cells/μl): 18.58 (8.52-32.6) and 55.67 (43.65-85.43), p <0.05, respectively was found.
In patients infected with R5-tropic HIV, there were no significant differences in the content of these cells depending on AIDS presence.
Conclusions. In patients with non R5-tropic HIV, the formation of AIDS, unlike patients with R5-tropic HIV, showed a pronounced activation of T-cell immunity, a decrease in the content of CD4+CD25+T-regulatory cells and CD4+CCR5+T-cells, which indicates different immunological mechanisms of AIDS formation at HIV-infection with different virus tropism.
Mr. Adeolu Oluremi
Lecturer
Babcock University
The Risk of Hepatitis B and C Virus Infection in HIV Positive Individuals Attending General Hospitals in Southwestern Nigeria
Abstract
Backgrounds: Triple infection of Hepatitis B virus (HBV), hepatitis C virus (HCV) and human immunodeficiency virus (HIV) can results in increased hepatic complications. This study aimed to evaluate the prevalence of HBV and HCV in HIV infected individuals on HAART attending general hospitals in southwestern Nigeria. Materials and Methods: Ethical approval was obtained from Ministry of Health, Nigeria and data was fetched through an informed consent questionnaire. A total of 891 HIV infected individuals participated in the study. Samples were tested for hepatitis B surface antigen (HBsAg) and anti-HCV antibodies by rapid assay and later confirmed with enzyme linked Immunosorbent assay (ELISA). Hepatitis B e antigen (HBeAg) and anti-HBe antibodies were tested on HBsAg positive samples. Quantification of HBVDNA was performed with quantitative real-time PCR. HBV-DNA and HCV-RNA were extracted from each sample and subjected to polymerase Chain reaction (PCR) using specific primers and PCR conditions. Each PCR products was then electrophoresed on 1.5% agarose gel. Data was analyzed using packages within SPSS software and p-values less than 0.05 was considered significant. Results: Triple infection of HBV, HCV and HIV was seen in 27 (3.03%). Co-infection of HIV with of HBeAg and anti-HBe antibodies was seen in 108 (12.1%) and 297 (33.3%) respectively. Serum concentration of ALT and AST were higher in those with triple infection than those with co-infection. Average CD4 count in triple infection was 136cell/mm3 compare to 201cell/mm3 of those with co-infection. Averagely, the HBV viral load in triple infection was 59copies/ml compares to 70copies/ml in co-infection in the OBI samples. The mean average age is 27 years. Sexual promiscuity, blood transfusion history and multiple sex partners were significantly associated with triple infection (p=0.04; p=0.05 and p=0.049) respectively. Conclusion: This study found high prevalence of triple infection and co-infection of HIV, HBV and HCV among study population. This is alarming; therefore HBV and HCV screening must be compulsory included in routine screening of HIV positive individuals in Nigeria. Also liver enzymes must be closely monitored in those with triple and co-infection
Dr Stefania Paolucci
Biologa
IRCCS Policlinico San Matteo
Viral dynamics among HCV infected patients with different genotypes treated with genotypic specific or pan-genotypic direct-acting antiviral agent combinations
Abstract
Background: New hepatitis C virus (HCV) therapies have improved efficacy, allowed pangenotypic applications, increased barriers to drug resistance and shortened therapy duration.
Methods: Patients infected with different HCV genotypes were divided into two groups: group 1 included 169 patients receiving genotypic specific regimens (GSR), while group 2 included 186 patients receiving pan-genotypic regimens (PGR). Patient’s HCV RNA was quantified and sequenced.
Results: Comparable sustained viral response (SVR) rates were observed in both GSR and PGR treated patients. Nevertheless, a greater proportion of non-detectable levels (NDL) of HCV RNA was observed in patients treated with PGR as compared with GSR. Overall, among patients in the GSR and PGR groups with residual viremia, 124/169 (73.4%) and 125/186 (67.2%) at four weeks, and 66/169 (39.1%) and 58/186 (31.2%) at eight weeks, achieved SVR. No difference was observed in the clinical outcome comparing patients in the GSR and PGR groups according to genotype. While, comparing patients between the two groups, the proportion of patients with NDL HCV RNA at four and eight weeks was higher in patients infected with genotype 1b treated with PGR (p=0.05). A significantly higher number of patients infected with 1b had RASs at baseline (p=0.0001). In addition, the proportion of patients with treatment failure was higher in patients with RASs at baseline compared with those without (p= 0.012). Overall, 2.5% patients failed to achieve SVR after DAA treatment.
Conclusions: A sharp HCV RNA decrease was observed in patients treated with both GSR and PGR. However, even if comparable, a slightly greater number of patients treated with PGR achieved NDL HCV RNA as compared with GSR. A significant difference was observed in patients with baseline RASs, both in relation to treatment failure and genotype. In conclusion, the use of new DAA combinations helps patients achieve a more rapid virologic response.
Methods: Patients infected with different HCV genotypes were divided into two groups: group 1 included 169 patients receiving genotypic specific regimens (GSR), while group 2 included 186 patients receiving pan-genotypic regimens (PGR). Patient’s HCV RNA was quantified and sequenced.
Results: Comparable sustained viral response (SVR) rates were observed in both GSR and PGR treated patients. Nevertheless, a greater proportion of non-detectable levels (NDL) of HCV RNA was observed in patients treated with PGR as compared with GSR. Overall, among patients in the GSR and PGR groups with residual viremia, 124/169 (73.4%) and 125/186 (67.2%) at four weeks, and 66/169 (39.1%) and 58/186 (31.2%) at eight weeks, achieved SVR. No difference was observed in the clinical outcome comparing patients in the GSR and PGR groups according to genotype. While, comparing patients between the two groups, the proportion of patients with NDL HCV RNA at four and eight weeks was higher in patients infected with genotype 1b treated with PGR (p=0.05). A significantly higher number of patients infected with 1b had RASs at baseline (p=0.0001). In addition, the proportion of patients with treatment failure was higher in patients with RASs at baseline compared with those without (p= 0.012). Overall, 2.5% patients failed to achieve SVR after DAA treatment.
Conclusions: A sharp HCV RNA decrease was observed in patients treated with both GSR and PGR. However, even if comparable, a slightly greater number of patients treated with PGR achieved NDL HCV RNA as compared with GSR. A significant difference was observed in patients with baseline RASs, both in relation to treatment failure and genotype. In conclusion, the use of new DAA combinations helps patients achieve a more rapid virologic response.
Dr. Victor Pimentel
Post Doc
Instituto De Higiene E Medicina Tropical
Frequent transmission of HIV-1 subtype C harboring L90M mutation in patients followed in Portugal.
Abstract
Background: Human immunodeficiency virus type 1 (HIV-1) subtype C accounts for approximately 48% of all people living with HIV, representing the most prevalent HIV-1 subtype in the world. Current advancements in antiretroviral therapy (ART) have turned HIV-1 infection into a chronic and manageable disease. However, treatment is only effective until HIV-1 develops resistance against the administered drugs. The aim of this study was to identify and characterize transmission clusters of subtype C containing the L90M mutation in Portugal.
Methods: Epidemiological, clinical and viral sequence data from 503 HIV-1 subtype C infected patients followed in Portugal between 2001 and 2016 were included, of which 32 had L90M mutation. 13118 unique background control sequences from subtype C were selected by blasting our sequences against Los Alamos database. Phylogenetic tree reconstruction was performed with FastTree software v.2.1. Cluster Picker was used to identify transmission clusters according to a threshold based on a genetic distance > 0.45 and a bootstrap support > 90%. Bayesian phylogenetic inference was performed with BEAST v1.8.4 to analyze the temporal dynamics of HIV-1 subtype C L90M transmission. Statistical analyses were performed to identify possible correlates of clustering.
Results: 204 (41%) portuguese patients were in transmission clusters. Portuguese patients harboring L90M mutation were 2 times more likely to be in clusters than patients from other countries (60%) (IC 95%: 42%-74%) vs 35% (IC95%: 26%-44%; p<0.001). The largest Portuguese C L90M cluster was composed of 14 patients, mainly drug naïve. Bayesian coalescent analyses suggested that this mutation was introduced in Portugal in 1992 while its transmission ignited in 2004.
Conclusion: Our results indicate continuous transmission of HIV-1 subtype C L90M strains in Portugal, with its origin dated back to the early 1990s. However, further analysis is necessary to clarify what determines this higher rate of transmission of L90M in Portuguese patients infected with subtype C.
BEST-HOPE study group: Domítilia Faria, Raquel Pinho, José Ferreira, Paula Proença, Sofia Nunes, Margarida Mouro, Eugénio Teófilo, Sofia Pinheiro, Fernando Maltez, Maria José Manata, Isabel Germano, Joana Simões, Olga Costa, Rita Corte-Real, António Diniz, Margarida Serrado, Luís Caldeira, Nuno Janeiro, Guilhermina Gaião, José Melo Cristino, Kamal Mansinho, Teresa Baptista, Perpétua Gomes, Isabel Diogo, Rosário Serrão, Carmela Pinheiro, Carmo Koch, Fátima Monteiro, Mª João Gonçalves, Rui Sarmento e Castro, Helena Ramos, Joaquim Oliveira, José Saraiva da Cunha, Vanda Mota, Fernando Rodrigues, Raquel Tavares, Ana Rita Silva, Fausto Roxo, Maria Saudade Ivo, José Poças, Bianca Ascenção, Patrícia Pacheco, Micaela Caixeiro, Nuno Marques, Maria João Aleixo, Telo Faria, Elisabete Gomes da Silva, Ricardo Correia de Abreu and Isabel Neves.
Methods: Epidemiological, clinical and viral sequence data from 503 HIV-1 subtype C infected patients followed in Portugal between 2001 and 2016 were included, of which 32 had L90M mutation. 13118 unique background control sequences from subtype C were selected by blasting our sequences against Los Alamos database. Phylogenetic tree reconstruction was performed with FastTree software v.2.1. Cluster Picker was used to identify transmission clusters according to a threshold based on a genetic distance > 0.45 and a bootstrap support > 90%. Bayesian phylogenetic inference was performed with BEAST v1.8.4 to analyze the temporal dynamics of HIV-1 subtype C L90M transmission. Statistical analyses were performed to identify possible correlates of clustering.
Results: 204 (41%) portuguese patients were in transmission clusters. Portuguese patients harboring L90M mutation were 2 times more likely to be in clusters than patients from other countries (60%) (IC 95%: 42%-74%) vs 35% (IC95%: 26%-44%; p<0.001). The largest Portuguese C L90M cluster was composed of 14 patients, mainly drug naïve. Bayesian coalescent analyses suggested that this mutation was introduced in Portugal in 1992 while its transmission ignited in 2004.
Conclusion: Our results indicate continuous transmission of HIV-1 subtype C L90M strains in Portugal, with its origin dated back to the early 1990s. However, further analysis is necessary to clarify what determines this higher rate of transmission of L90M in Portuguese patients infected with subtype C.
BEST-HOPE study group: Domítilia Faria, Raquel Pinho, José Ferreira, Paula Proença, Sofia Nunes, Margarida Mouro, Eugénio Teófilo, Sofia Pinheiro, Fernando Maltez, Maria José Manata, Isabel Germano, Joana Simões, Olga Costa, Rita Corte-Real, António Diniz, Margarida Serrado, Luís Caldeira, Nuno Janeiro, Guilhermina Gaião, José Melo Cristino, Kamal Mansinho, Teresa Baptista, Perpétua Gomes, Isabel Diogo, Rosário Serrão, Carmela Pinheiro, Carmo Koch, Fátima Monteiro, Mª João Gonçalves, Rui Sarmento e Castro, Helena Ramos, Joaquim Oliveira, José Saraiva da Cunha, Vanda Mota, Fernando Rodrigues, Raquel Tavares, Ana Rita Silva, Fausto Roxo, Maria Saudade Ivo, José Poças, Bianca Ascenção, Patrícia Pacheco, Micaela Caixeiro, Nuno Marques, Maria João Aleixo, Telo Faria, Elisabete Gomes da Silva, Ricardo Correia de Abreu and Isabel Neves.
Phd Ana Planinić
Research Associate, molecular biologist
University Hospital For Infectous Diseases ˝dr. Fran Mihaljević˝
Title: Time trends in HIV-1 diversity in Croatia: a follow up on HIV-1 subtype distribution
Abstract
BACKGROUND: The geographical distribution and prevalence of HIV-1 subtypes in Europe are highly heterogeneous. Subtype B is predominant in Western and Central Europe but non-B subtypes, introduced mainly via migration, are also present in the region. Croatia is a small Central European country with distribution of HIV-1 subtypes similar to that of other European countries dominated by subtype B. Several studies on HIV-1 subtype distribution have been published in Croatia so far that show that the most common HIV-1 subtype is subtype B. Molecular analysis of HIV subtypes in period 2001-2003 showed a high prevalence of subtype B (>74%) with non-B subtypes found only in heterosexuals. A study on transmitted-drug resistance (TDR) in newly diagnosed HIV-infected patients conducted in the period 2006-2008 showed a high prevalence of subtype B among MSM population with only 11 % of patients infected with non-B subtypes. Subtype B was also confirmed as predominant in respond-driven sampling (RDS) study among MSM conducted in 2006 and 2010. The aim of this study is to show a more recent data on of HIV-1 subtype distribution in newly diagnosed patients in Croatia and compare it with previous years.
MATERIALS AND METHODS: The study included all newly diagnosed HIV-1 patients during 2014-2017. The mean age was 36.3 (0-67) years and males accounted for 95.3% of the study population (385/404). The most common route of transmission was MSM (87.9%, 355/404), followed by heterosexual transmission (10.4%, 42/404), IDU (0.5%, 2/404) and mother-to-child transmission (MTCT) (0.5%, 2/404). Partial pol gene sequences were generated from 404 samples and analysed by using REGA HIV-1 subtyping tool version 3.0.
RESULTS: Subtype B was detected in 368 samples (91.2%), followed by sub-subtype A1 (4.2%, n= 19), subtype C (1.73% n=7), CRF02_AG (0.7%, n= 3), CRF06_CPX (0.5%, n=2), recombinant forms A1-C (0.5%, n=2), A1-G (0.25%, n=1), A1-B (0.25%, n=1) and (CRF) 01_AE (0.25%, n=1). Within the subtype B group there was a predominance of males belonging to MSM group (82.4%, 333/404). Males accounted for 7.2% (29/404) of non-B subtype infections compared to 1.7% of females (7/404). According to other risk groups, 8.7% (n=35) of subtype B infections were due to heterosexual, IDU or MTCT transmission compared to 3.5 % (n=14) of non-B subtype infections.
CONCLUSIONS: Croatia belongs in the group of Balkan countries with the highest prevalence of subtype B but significant number of non-B subtypes was introduced into the population from different sources. The present study confirmed that the epidemic in Croatia was predominantly affecting MSM infected with subtype B but the appearance of different non-B subtypes demonstrate molecular heterogeneity of HIV-infections in Croatia. Heterosexual and IDU risk group are still linked to infection with non-B subtypes but we observed a recent rise of non-B subtypes, (sub-subtype A1 being most prevalent) in MSM risk group, most probably caused by traveling abroad. Despite the increased spread of various non-B subtypes, the origin and risk group to which the patient is linked still remain a good subtype prediction.
MATERIALS AND METHODS: The study included all newly diagnosed HIV-1 patients during 2014-2017. The mean age was 36.3 (0-67) years and males accounted for 95.3% of the study population (385/404). The most common route of transmission was MSM (87.9%, 355/404), followed by heterosexual transmission (10.4%, 42/404), IDU (0.5%, 2/404) and mother-to-child transmission (MTCT) (0.5%, 2/404). Partial pol gene sequences were generated from 404 samples and analysed by using REGA HIV-1 subtyping tool version 3.0.
RESULTS: Subtype B was detected in 368 samples (91.2%), followed by sub-subtype A1 (4.2%, n= 19), subtype C (1.73% n=7), CRF02_AG (0.7%, n= 3), CRF06_CPX (0.5%, n=2), recombinant forms A1-C (0.5%, n=2), A1-G (0.25%, n=1), A1-B (0.25%, n=1) and (CRF) 01_AE (0.25%, n=1). Within the subtype B group there was a predominance of males belonging to MSM group (82.4%, 333/404). Males accounted for 7.2% (29/404) of non-B subtype infections compared to 1.7% of females (7/404). According to other risk groups, 8.7% (n=35) of subtype B infections were due to heterosexual, IDU or MTCT transmission compared to 3.5 % (n=14) of non-B subtype infections.
CONCLUSIONS: Croatia belongs in the group of Balkan countries with the highest prevalence of subtype B but significant number of non-B subtypes was introduced into the population from different sources. The present study confirmed that the epidemic in Croatia was predominantly affecting MSM infected with subtype B but the appearance of different non-B subtypes demonstrate molecular heterogeneity of HIV-infections in Croatia. Heterosexual and IDU risk group are still linked to infection with non-B subtypes but we observed a recent rise of non-B subtypes, (sub-subtype A1 being most prevalent) in MSM risk group, most probably caused by traveling abroad. Despite the increased spread of various non-B subtypes, the origin and risk group to which the patient is linked still remain a good subtype prediction.
Ms. Preethi Raghavan
Pharmacist
Hospital Sungai Buloh
Impact of point-of-care pharmacist counseling at late refills of antiretroviral therapy: A Study Following the Early Warning Indicators of World Health Organization Recommendations
Abstract
Background:
With increasing global use of antiretroviral therapy (ART), World Health Organization (WHO) has developed HIV drug resistance (HIVDR) Early Warning Indicators (EWIs) to optimize prevention of HIVDR. Recent studies have reported on time pharmacy refills, the fourth EWI, to be the strongest predictor of clinic-level viral load suppression. The primary objective of this study was to assess the impact of pharmacist counseling at the point of late ART refill. We also sought to determine the percentage of patients who picked up prescribed antiretroviral drugs on time as described by WHO, common reasons and predictors for late refills.
Method:
A cross-sectional study was conducted among 751 Malaysian HIV-infected individuals receiving ART from November 2017 until February 2018. Patients with late refills were actively absorbed for a comprehensive counseling session. Follow-up pharmacy refills after the counselling was then evaluated using medication possession ratio (MPR) for a duration of 6 months. MPR of more than 90% was categorized as optimal refill adherence according to published conventions. Paired T-test was used to test the effectiveness of counselling at late refills whilst multivariate regression models were used to examine predictors of late refills.
Results:
Of 751 HIV-infected patients, 91% had on time refills. Patients with late refills (n=65) were predominantly male (85%), of Malay ethnicity (45%) and age 35 years old and above (65%). Mean duration on ART was 4 years. Being outstation accounted for the highest reasons for late refills (32%) followed by 23% due to work commitments. Identifying patients with late refills and providing concurrent counseling increases MPR or refill adherence significantly in patients who had previously poor MPR scores (MD=14.76; SD= 18.04; p=0.001). Multivariate binary logistic regression analysis found history of self-reported non-adherence (AOR= 4.506; 95% CI [1.822-11.143]; P=0.001) and travelling more than 20km to the hospital (AOR= 4.749; 95% CI [1.966-11.474]; P=0.001) were significant predictors of late refills.
Conclusion:
Although the proportion of patients with on time pill pick up was desirable, our study further suggests integration of identification and counseling for patients with late refills as it significantly increases pharmacy refill adherence. This targeted intervention could serve as an early proxy of retention in care especially in resource-limited settings.
With increasing global use of antiretroviral therapy (ART), World Health Organization (WHO) has developed HIV drug resistance (HIVDR) Early Warning Indicators (EWIs) to optimize prevention of HIVDR. Recent studies have reported on time pharmacy refills, the fourth EWI, to be the strongest predictor of clinic-level viral load suppression. The primary objective of this study was to assess the impact of pharmacist counseling at the point of late ART refill. We also sought to determine the percentage of patients who picked up prescribed antiretroviral drugs on time as described by WHO, common reasons and predictors for late refills.
Method:
A cross-sectional study was conducted among 751 Malaysian HIV-infected individuals receiving ART from November 2017 until February 2018. Patients with late refills were actively absorbed for a comprehensive counseling session. Follow-up pharmacy refills after the counselling was then evaluated using medication possession ratio (MPR) for a duration of 6 months. MPR of more than 90% was categorized as optimal refill adherence according to published conventions. Paired T-test was used to test the effectiveness of counselling at late refills whilst multivariate regression models were used to examine predictors of late refills.
Results:
Of 751 HIV-infected patients, 91% had on time refills. Patients with late refills (n=65) were predominantly male (85%), of Malay ethnicity (45%) and age 35 years old and above (65%). Mean duration on ART was 4 years. Being outstation accounted for the highest reasons for late refills (32%) followed by 23% due to work commitments. Identifying patients with late refills and providing concurrent counseling increases MPR or refill adherence significantly in patients who had previously poor MPR scores (MD=14.76; SD= 18.04; p=0.001). Multivariate binary logistic regression analysis found history of self-reported non-adherence (AOR= 4.506; 95% CI [1.822-11.143]; P=0.001) and travelling more than 20km to the hospital (AOR= 4.749; 95% CI [1.966-11.474]; P=0.001) were significant predictors of late refills.
Conclusion:
Although the proportion of patients with on time pill pick up was desirable, our study further suggests integration of identification and counseling for patients with late refills as it significantly increases pharmacy refill adherence. This targeted intervention could serve as an early proxy of retention in care especially in resource-limited settings.
Prof. Maria Mercedes Santoro
Associate Professor
University of Rome Tor Vergata
Drug Resistance dynamics in isolates from HIV-1 Infected individuals with Mother-to-Child-Transmission in Italy from 1999 to 2017
Abstract
Background: In developed settings, perinatally acquired HIV-1 infection has become a chronic disease of childhood with increasing numbers of adolescents surviving to adulthood. Perinatally infected individuals have been heavily pretreated, and have a long history of antiretroviral treatment (ART), including sub-optimal regimens. This can increase the prevalence of drug-resistance, compromising the success of present and future treatment options. Only few data exist in literature about drug-resistance in HIV-1 individuals infected through mother-to-child transmission (MTCT) in Western countries. Thus, we evaluated the temporal trend of HIV-1 drug-resistance in this vulnerable population.
Materials & Methods: We included ART-experienced individuals HIV-1 infected through MTCT with at least one available plasma genotypic resistance test (GRT) for protease/reverse transcriptase and (when available) integrase, followed up in Central Italy from 1999 to 2017. The trends of resistance to NNRTIs, NRTIs, PIs and INIs, and resistance to 1, 2 and ≥3 classes were evaluated using the Stanford mutations list 2018 according to the following time periods: 1999-2002, 2003-2015, 2006-2008, 2009-2011, 2012-2014, 2015-2017.
Results: We analyzed 554 plasma GRTs from 193 ART-experienced individuals HIV-1 infected through MTCT. Nearly half of the individuals were born in Italy (47.2%) and were male (50.8%); 108 (55.6%) individuals were infected with HIV-1 B; among non-B subtypes, the most prevalent were CRF02_AG (17.1%), F (13.5%) and C (5.7%). Patients were born in a median (IQR) year of 1993 (1989-1998); their median (IQR) age at first-line regimen was 2 (1-2) years, while their median (IQR) age at the moment of GRT was 17 (12-22) years. During their treatment history, around 63% of individuals received a sub-optimal ART based on NRTI dual/monotherapy or unboosted-PI.
Overall, 69.3% of isolates showed resistance to any drug class; in particular, 35.0%, 58.7%, 45.8% 3.1% of isolates showed resistance to PIs, NRTIs, NNRTIs and INIs (N=184), respectively.
Overall, resistance to any drug class dramatically decreased from 90% in 1999-2002 up to 44.2 % in 2015-2017 in conjunction with a remarkable increase of GRTs without resistance (from 10% to 55.8%, p<0.001). More specifically, a significant decrease of resistance to 2 classes (from 48.3% to 5.8%; p<0.001) and ≥3 classes (from 23.3% to 7.7%, p<0.001) was observed from 1999-2002 to 2015-2017. By contrast, resistance to one class was almost stable up to 2014 (from 18.3% in 1999-2002 to 18.4% in 2012-2014, p=0.608), but increased in 2015-2017 (30.8% in 2015-2017 vs. 18.4% in 2012-2014, p=0.085).
Concerning the specific drug classes, the trends of resistance from 1999-2002 to 2015-2017 periods were as follows: PIs (from 53.3% to 11.5%, p<0.001), NRTIs (from 86.7% to 21.2%, p<0.001) and NNRTIs (from 45.0% to 28.8%, p=0.001). Resistance to INIs significantly increased from 0.7% in 2006-2008 to 5.8% in 2015-2017 (p=0.018).
Conclusions: In HIV-1 perinatally infected individuals followed in Italy, a dramatic drop of drug-resistance has been achieved over time. However, drug-resistance to INIs is increasing and resistance to ≥3 classes remains a concern that deserves clinical attention in this fragile population.
Materials & Methods: We included ART-experienced individuals HIV-1 infected through MTCT with at least one available plasma genotypic resistance test (GRT) for protease/reverse transcriptase and (when available) integrase, followed up in Central Italy from 1999 to 2017. The trends of resistance to NNRTIs, NRTIs, PIs and INIs, and resistance to 1, 2 and ≥3 classes were evaluated using the Stanford mutations list 2018 according to the following time periods: 1999-2002, 2003-2015, 2006-2008, 2009-2011, 2012-2014, 2015-2017.
Results: We analyzed 554 plasma GRTs from 193 ART-experienced individuals HIV-1 infected through MTCT. Nearly half of the individuals were born in Italy (47.2%) and were male (50.8%); 108 (55.6%) individuals were infected with HIV-1 B; among non-B subtypes, the most prevalent were CRF02_AG (17.1%), F (13.5%) and C (5.7%). Patients were born in a median (IQR) year of 1993 (1989-1998); their median (IQR) age at first-line regimen was 2 (1-2) years, while their median (IQR) age at the moment of GRT was 17 (12-22) years. During their treatment history, around 63% of individuals received a sub-optimal ART based on NRTI dual/monotherapy or unboosted-PI.
Overall, 69.3% of isolates showed resistance to any drug class; in particular, 35.0%, 58.7%, 45.8% 3.1% of isolates showed resistance to PIs, NRTIs, NNRTIs and INIs (N=184), respectively.
Overall, resistance to any drug class dramatically decreased from 90% in 1999-2002 up to 44.2 % in 2015-2017 in conjunction with a remarkable increase of GRTs without resistance (from 10% to 55.8%, p<0.001). More specifically, a significant decrease of resistance to 2 classes (from 48.3% to 5.8%; p<0.001) and ≥3 classes (from 23.3% to 7.7%, p<0.001) was observed from 1999-2002 to 2015-2017. By contrast, resistance to one class was almost stable up to 2014 (from 18.3% in 1999-2002 to 18.4% in 2012-2014, p=0.608), but increased in 2015-2017 (30.8% in 2015-2017 vs. 18.4% in 2012-2014, p=0.085).
Concerning the specific drug classes, the trends of resistance from 1999-2002 to 2015-2017 periods were as follows: PIs (from 53.3% to 11.5%, p<0.001), NRTIs (from 86.7% to 21.2%, p<0.001) and NNRTIs (from 45.0% to 28.8%, p=0.001). Resistance to INIs significantly increased from 0.7% in 2006-2008 to 5.8% in 2015-2017 (p=0.018).
Conclusions: In HIV-1 perinatally infected individuals followed in Italy, a dramatic drop of drug-resistance has been achieved over time. However, drug-resistance to INIs is increasing and resistance to ≥3 classes remains a concern that deserves clinical attention in this fragile population.
Pr. Evelyne Schvoerer
Professor
CHRU de Nancy
Ultra-Deep Sequencing in real-life conditions: highlights from first assays on HIV and HEV - Virology laboratory, University hospital of Nancy, France.
Abstract
Backgrounds: Sanger population sequencing has been the reference to monitor HIV1-infected patients’ antiretroviral (ARV) therapy, but Ultra-Deep Sequencing (UDS), sensitive and quantitative, may be an alternative. The present report aimed to analyze original features by comparing UDS versus Sanger sequencing on HIV and hepatitis E virus (HEV).
Materials & methods: Plasma samples from 12 HIV-infected patients and 8 HEV-infected patients were studied by Sanger and UDS (MiSeq/Illumina). HIV genome was studied either within Env V3 loop (R5/X4 tropism, n=8 patients), or in protease/reverse transcriptase/integrase, n=4 patients; for HEV, ORF2/3 gene overlap was studied for 8 patients. The data were analyzed by bioinformatics for variability (MEGA/Geneious). For UDS, nucleic acid coverage at a mean of 20000 reads and amino acid cut-off at 1% were considered.
Results: For HIV, similar results or silent mutations were observed for 9/12 patients by Sanger and UDS. For one patient, one minor Env-V3 loop variant was X4-tropic by UDS (16%) while Sanger concluded as R5-tropic. For the two others, UDS demonstrated a wild type residue at position 143 and 263 within integrase in spite of ambiguous results by Sanger. For HEV, similar results were observed by Sanger and UDS concerning the major variants of 7/8 patients. For the last one, suffering from chronic HEV infection, UDS showed a high heterogeneous quasispecies with multiple variants and major variants at only 6.96 % (ORF2) and 10.63 % (ORF3). Elsewhere, for one patient, we observed a major variant at 80.91 % according to ORF2 while at 43.1 % for ORF3.
Discussion
UDS for HIV resistance genotyping can provide useful information with possible consequences for resistance testing. Mutations found on HIV Env-V3 loop or in HEV ORF2/3 gene only by UDS might be explained by previous selection pressure from host-related immunity. Previous ARV therapy can also influence viral quasispecies.
Materials & methods: Plasma samples from 12 HIV-infected patients and 8 HEV-infected patients were studied by Sanger and UDS (MiSeq/Illumina). HIV genome was studied either within Env V3 loop (R5/X4 tropism, n=8 patients), or in protease/reverse transcriptase/integrase, n=4 patients; for HEV, ORF2/3 gene overlap was studied for 8 patients. The data were analyzed by bioinformatics for variability (MEGA/Geneious). For UDS, nucleic acid coverage at a mean of 20000 reads and amino acid cut-off at 1% were considered.
Results: For HIV, similar results or silent mutations were observed for 9/12 patients by Sanger and UDS. For one patient, one minor Env-V3 loop variant was X4-tropic by UDS (16%) while Sanger concluded as R5-tropic. For the two others, UDS demonstrated a wild type residue at position 143 and 263 within integrase in spite of ambiguous results by Sanger. For HEV, similar results were observed by Sanger and UDS concerning the major variants of 7/8 patients. For the last one, suffering from chronic HEV infection, UDS showed a high heterogeneous quasispecies with multiple variants and major variants at only 6.96 % (ORF2) and 10.63 % (ORF3). Elsewhere, for one patient, we observed a major variant at 80.91 % according to ORF2 while at 43.1 % for ORF3.
Discussion
UDS for HIV resistance genotyping can provide useful information with possible consequences for resistance testing. Mutations found on HIV Env-V3 loop or in HEV ORF2/3 gene only by UDS might be explained by previous selection pressure from host-related immunity. Previous ARV therapy can also influence viral quasispecies.
Dr Hong Su
Scientist
Abbott
Design and Performance of the new Alinity m HCV Assay
Abstract
Background:
The WHO estimates that 71 million people have a chronic hepatitis C infection, and nearly 400,000 individuals die each year from complications of hepatitis C, primarily of cirrhosis and liver cancer. In order to realize the value of the new antivirals, testing strategies must improve. Alinity m HCV assay was developed with a goal of streamlining the diagnostic process. By providing simultaneous confirmation of viremic infection and baseline viral load measurement in one test, Alinity m HCV reduces the number of tests and steps required for the initial diagnosis of HCV infection. Here we evaluate key performance attributes of the Alinity m HCV assay.
Methods:
To ensure robustness against the new and emerging HCV variants, the Alinity m HCV assay was developed as a dual-probe assay targeting a highly conserved region of the HCV genome. The Alinity m System utilizes magnetic microparticle sample preparation chemistry, unit-dose lyophilized amplification reagents, and ReadiFlexTM sample processing. Linearity, Limit of Detection (LOD) and precision studies were evaluated using either the 4th WHO HCV International Standard (NIBSC 06/102 genotype 1) or HCV positive clinical specimens diluted in HCV negative serum and plasma. Clinical performance and correlation were evaluated against comparator methods using both plasma and serum specimens.
Results:
The Alinity m HCV assay demonstrated linearity from 12 IU/mL to 200,000,000 IU/ml. Probit analysis demonstrated that the Alinity m HCV assay detected HCV RNA with 95% probability at 5.11 IU/mL for genotype 1 in both plasma and serum. The assay also exhibited 95% or greater detection rates with HCV genotypes 2-6 at 12 IU/mL. An overall specificity of 100.0% (95% CI: 99.2 to 100.0%) was determined by testing HCV negative specimens, including 250 plasma and 254 serum. In a 5-day precision study, the Alinity m HCV assay demonstrated a within-laboratory SD of ≤ 0.16 Log IU/mL of HCV RNA from 1.43 to 8.42 Log IU/mL, and an SD of 0.18 Log IU/mL at 1.40 Log IU /mL. Method correlation to Abbott RealTime HCV (n=362) demonstrated a correlation coefficient of 0.978, slope of 1.03 and intercept of 0.02 using the Deming Regression. The Positive (n=363, 178 plasma and 185 serum) and Negative (n=299, 149 plasma and 150 serum) agreement was 100% between Alinity m HCV and a comparator CE-marked confirmatory assay.
Conclusions:
The Alinity m HCV assay deliver highly sensitive detection of diverse HCV genotypes and accurate quantitation across a wide dynamic range. This assay performance is further enhanced by rapid turnaround time (time-to-first-result of 115 minutes) and workflow flexibility of the Alinity m System.
The WHO estimates that 71 million people have a chronic hepatitis C infection, and nearly 400,000 individuals die each year from complications of hepatitis C, primarily of cirrhosis and liver cancer. In order to realize the value of the new antivirals, testing strategies must improve. Alinity m HCV assay was developed with a goal of streamlining the diagnostic process. By providing simultaneous confirmation of viremic infection and baseline viral load measurement in one test, Alinity m HCV reduces the number of tests and steps required for the initial diagnosis of HCV infection. Here we evaluate key performance attributes of the Alinity m HCV assay.
Methods:
To ensure robustness against the new and emerging HCV variants, the Alinity m HCV assay was developed as a dual-probe assay targeting a highly conserved region of the HCV genome. The Alinity m System utilizes magnetic microparticle sample preparation chemistry, unit-dose lyophilized amplification reagents, and ReadiFlexTM sample processing. Linearity, Limit of Detection (LOD) and precision studies were evaluated using either the 4th WHO HCV International Standard (NIBSC 06/102 genotype 1) or HCV positive clinical specimens diluted in HCV negative serum and plasma. Clinical performance and correlation were evaluated against comparator methods using both plasma and serum specimens.
Results:
The Alinity m HCV assay demonstrated linearity from 12 IU/mL to 200,000,000 IU/ml. Probit analysis demonstrated that the Alinity m HCV assay detected HCV RNA with 95% probability at 5.11 IU/mL for genotype 1 in both plasma and serum. The assay also exhibited 95% or greater detection rates with HCV genotypes 2-6 at 12 IU/mL. An overall specificity of 100.0% (95% CI: 99.2 to 100.0%) was determined by testing HCV negative specimens, including 250 plasma and 254 serum. In a 5-day precision study, the Alinity m HCV assay demonstrated a within-laboratory SD of ≤ 0.16 Log IU/mL of HCV RNA from 1.43 to 8.42 Log IU/mL, and an SD of 0.18 Log IU/mL at 1.40 Log IU /mL. Method correlation to Abbott RealTime HCV (n=362) demonstrated a correlation coefficient of 0.978, slope of 1.03 and intercept of 0.02 using the Deming Regression. The Positive (n=363, 178 plasma and 185 serum) and Negative (n=299, 149 plasma and 150 serum) agreement was 100% between Alinity m HCV and a comparator CE-marked confirmatory assay.
Conclusions:
The Alinity m HCV assay deliver highly sensitive detection of diverse HCV genotypes and accurate quantitation across a wide dynamic range. This assay performance is further enhanced by rapid turnaround time (time-to-first-result of 115 minutes) and workflow flexibility of the Alinity m System.
Dr. Bin Su
Associate Researcher,associate Professor
Beijing Youan Hospital, Capital Medical University
Lack of HIV-1 integrase inhibitor resistances among 392 antiretroviral-naïve subjects in a tertiary care hospital in Beijing, China
Abstract
Background: Integrase strand transfer inhibitors (INSTIs) have high potency, high barriers to resistance, and good tolerability, and INSTIs have become an important part of antiretroviral therapy (ART) since the introduction of raltegravir (RAL) in 2007. Currently, RAL and dolutegravir (DTG) are included in the first-line regimen recommended by the "Society of Infectious Diseases of Chinese Medical Association". No major INSTI mutations were found among primary HIV-1 infected individuals in America, Europe, and Australia, but few data are available about the prevalence of HIV-1 INSTI resistance among ART-naïve patients in China. In this study, we characterized HIV-1 INSTI resistances among ART-naïve patients from a tertiary care hospital in Beijing, China.
Materials & Methods: Individuals with primary HIV-1 infection were enrolled in an observational Primo cohort in a tertiary care hospital in Beijing. We analyzed the HIV int gene from plasma of 392 antiretroviral-naïve patients with primary HIV-1 infection. All HIV-1-infected patients in the study were without HBV/HCV coinfection and other comorbidities, and none of them were drug users.
Results: No major INSTI mutations were identified among ART-naïve individuals in the study. However, two subjects harbored INSTI accessory mutations E157Q/T97A were detected for the first time. Thus, INSTI resistance mechanisms and to what extent these resistances impact the clinical effectiveness of INSTI need to be investigated in further studies.
Conclusions: Our results emphasize the need to consider testing for INSTI resistance at baseline as this class of drugs is increasingly used in clinical routine.
Materials & Methods: Individuals with primary HIV-1 infection were enrolled in an observational Primo cohort in a tertiary care hospital in Beijing. We analyzed the HIV int gene from plasma of 392 antiretroviral-naïve patients with primary HIV-1 infection. All HIV-1-infected patients in the study were without HBV/HCV coinfection and other comorbidities, and none of them were drug users.
Results: No major INSTI mutations were identified among ART-naïve individuals in the study. However, two subjects harbored INSTI accessory mutations E157Q/T97A were detected for the first time. Thus, INSTI resistance mechanisms and to what extent these resistances impact the clinical effectiveness of INSTI need to be investigated in further studies.
Conclusions: Our results emphasize the need to consider testing for INSTI resistance at baseline as this class of drugs is increasingly used in clinical routine.
Dr. Maryna Sukach
Assistant of ID department
O.O.Bogomolets National Medical University
Late presenters among persons with a new HIV diagnosis in Kyiv, Ukraine
Abstract
Background. In Ukraine, among 2892 new diagnosed cases of HIV-infection reported in January and February, 2019, 1498 (48%) were persons diagnosed having AIDS-defining condition. In general, late presentation is an important issue for healthcare and is associated with increased HIV-related morbidity and mortality, shorter survival, poor response to treatment, increased healthcare costs and increased rates of HIV transmission. The aim of the study was to analyze the characteristics of patients who were diagnosed late among newly diagnosed HIV-positive persons in Kyiv, Ukraine, in January-February, 2019.
Materials & Methods. We analysed data from records of newly diagnosed HIV-positive individuals who presented with with CD4 ≤ 200 cells/μL or AIDS (regardless of the CD4 cell count) defined as patients with advanced HIV disease (AHD) in Kyiv City HIV Centre in January-February, 2019. Descriptive analysis was performed to assess the prevalence and charasteristics of late presenters.
Results. The study included 139 patients (53 women - 38.1%, and 86 men - 61.9%) diagnosed with HIV infection at the time of AHD. The median age was 43,2 (IQR 24-78). 38 patients (27.3%) acqired HIV by injection drug use, 12 (8.6%) by homosexual and 89 (64.0%) by heterosexual contact. The most common AIDS defining conditions included: Pneumocystis pneumonia (in 60 patients - 43.2%), tuberculosis (in 79 - 56.8%), CNS toxoplasmosis (in 41 - 29.5%), oesophageal candidiasis (20 - 14.4%), chronic herpes simplex infection (in 58 - 41.7%), cytomegalovirus retinitis or meningoencephalitis (26 - 18.7%) and progressive multifocal leukoencephalopathy (4 - 2.9%). The median CD4 count was 45.4 (IQR 1-196) cells/μL. It was noted that 101 (72.7%) sought medical care during last 5 years, 88 (63.3%) were not offered an HIV test and 13 (9.4%) did not agree to do it before their condition became critical. 8 patients (5.7%) died within 2 months after being diagnosed with HIV. 128 patients (92.1%) started ART.
Conclusion. The results shows the rates of AIDS-defining conditions reported in newly diagnosed HIV-infected individuals in Kyiv in January-February, 2019. Pneumocystis pneumonia, tuberculosis, CNS toxoplasmosis, oesophageal candidiasis and cytomegalovirus retinitis or meningoencephalitis are reported among the most common opportunistic infections. The study also highlights the need of intensification of HIV testing strategy, showing that 63.3% of patients were not offered HIV test while seeking medical care within 5 years before being diagnosed with advanced HIV disease.
Materials & Methods. We analysed data from records of newly diagnosed HIV-positive individuals who presented with with CD4 ≤ 200 cells/μL or AIDS (regardless of the CD4 cell count) defined as patients with advanced HIV disease (AHD) in Kyiv City HIV Centre in January-February, 2019. Descriptive analysis was performed to assess the prevalence and charasteristics of late presenters.
Results. The study included 139 patients (53 women - 38.1%, and 86 men - 61.9%) diagnosed with HIV infection at the time of AHD. The median age was 43,2 (IQR 24-78). 38 patients (27.3%) acqired HIV by injection drug use, 12 (8.6%) by homosexual and 89 (64.0%) by heterosexual contact. The most common AIDS defining conditions included: Pneumocystis pneumonia (in 60 patients - 43.2%), tuberculosis (in 79 - 56.8%), CNS toxoplasmosis (in 41 - 29.5%), oesophageal candidiasis (20 - 14.4%), chronic herpes simplex infection (in 58 - 41.7%), cytomegalovirus retinitis or meningoencephalitis (26 - 18.7%) and progressive multifocal leukoencephalopathy (4 - 2.9%). The median CD4 count was 45.4 (IQR 1-196) cells/μL. It was noted that 101 (72.7%) sought medical care during last 5 years, 88 (63.3%) were not offered an HIV test and 13 (9.4%) did not agree to do it before their condition became critical. 8 patients (5.7%) died within 2 months after being diagnosed with HIV. 128 patients (92.1%) started ART.
Conclusion. The results shows the rates of AIDS-defining conditions reported in newly diagnosed HIV-infected individuals in Kyiv in January-February, 2019. Pneumocystis pneumonia, tuberculosis, CNS toxoplasmosis, oesophageal candidiasis and cytomegalovirus retinitis or meningoencephalitis are reported among the most common opportunistic infections. The study also highlights the need of intensification of HIV testing strategy, showing that 63.3% of patients were not offered HIV test while seeking medical care within 5 years before being diagnosed with advanced HIV disease.
Ms. Lauren Townsend
Medthink Scicom
HIV Replication at <40 c/mL for DTG+3TC vs DTG+TDF/FTC in the GEMINI 1&2 Studies
Abstract
Background: The GEMINI-1/-2 studies in treatment-naive adults with screening HIV-1 RNA ≤500,000 c/mL showed the 2-drug regimen (2DR) dolutegravir (DTG) + lamivudine (3TC) was non-inferior to the 3-drug regimen (3DR) DTG+TDF/FTC at Week 48 by FDA snapshot algorithm; 91% (655/716) in the 2DR group vs 93% (669/717) in the 3DR group achieved HIV-1 RNA <50 c/mL. Abbott RealTime HIV-1 assay used in the studies measures viral load (VL) from 40 to 10,000,000c/mL and provided qualitative target detected (TD) or target not detected (TND) for VL <40 c/mL. Clinical and subject management implications of more stringent low-level VL data needs clarification. We assessed the proportion of participants with TND over time and by baseline (BL) VL for 2DR vs 3DR.
Methods: Participants were randomized 1:1 to treatment with 2DR or 3DR. The proportion of participants with HIV-1 RNA <40 c/mL and TND status at Week 48 was analyzed using a Cochran-Mantel-Haenszel test stratified by plasma HIV-1 RNA (≤100,000 vs >100,000 c/mL) and CD4+ cell count (≤200 vs >200 cells/mm3) at BL. Proportion of participants with TND status were summarized by visit and at Week 48 by BL HIV-1 RNA subgroup. Time to plasma HIV-1 RNA <40 c/mL and TND status overall and by BL HIV-1 RNA subgroup were estimated using the non-parametric Kaplan-Meier method.
Results: At Week 48, a similar proportion of participants had snapshot TND in the 2DR and 3DR arms (77% [553/716] vs 73% [525/717]; adjusted difference 3.8%; 95% confidence interval: −0.6 to 8.2), and proportions were also similar at earlier visits: Weeks 4 (34% vs 32%), 8 (52% vs 49%), 12 (60% vs 57%), 16 (59% vs 56%), 24 (65% vs 63%), and 36 (65% vs 68%). While similar response rates were seen in participants with BL VL ≤100,000 c/mL, response rates were higher in 2DR vs 3DR participants with BL VL >100,000 c/mL. Median time for 2DR vs 3DR to TND was 57 days for both overall, 57 days for both in ≤100,000 c/mL at BL strata, and 113 vs 169 days for BL >100,000 c/mL subgroup.
Conclusions: DTG/3TC and DTG+TDF/FTC had similar proportions of TND by snapshot at all weeks. Snapshot response rates based on TND status at Week 48 were similar between arms at ≤100,000 c/mL BL subgroup and higher for DTG/3TC in >100,000 c/mL BL category. Median time to TND was similar overall and in BL VL ≤100,000 c/mL subgroup, and less for DTG/3TC vs DTG+TDF/FTC if >100,000 c/mL at BL. These data, utilizing a more stringent snapshot criteria, continue to demonstrate the effectiveness and potency of DTG+3TC in treatment-naive patients.
Data included in this abstract have been previously presented at the Conference on Retroviruses and Opportunistic Infections; March 4-7, 2019; Seattle, WA, USA.
Methods: Participants were randomized 1:1 to treatment with 2DR or 3DR. The proportion of participants with HIV-1 RNA <40 c/mL and TND status at Week 48 was analyzed using a Cochran-Mantel-Haenszel test stratified by plasma HIV-1 RNA (≤100,000 vs >100,000 c/mL) and CD4+ cell count (≤200 vs >200 cells/mm3) at BL. Proportion of participants with TND status were summarized by visit and at Week 48 by BL HIV-1 RNA subgroup. Time to plasma HIV-1 RNA <40 c/mL and TND status overall and by BL HIV-1 RNA subgroup were estimated using the non-parametric Kaplan-Meier method.
Results: At Week 48, a similar proportion of participants had snapshot TND in the 2DR and 3DR arms (77% [553/716] vs 73% [525/717]; adjusted difference 3.8%; 95% confidence interval: −0.6 to 8.2), and proportions were also similar at earlier visits: Weeks 4 (34% vs 32%), 8 (52% vs 49%), 12 (60% vs 57%), 16 (59% vs 56%), 24 (65% vs 63%), and 36 (65% vs 68%). While similar response rates were seen in participants with BL VL ≤100,000 c/mL, response rates were higher in 2DR vs 3DR participants with BL VL >100,000 c/mL. Median time for 2DR vs 3DR to TND was 57 days for both overall, 57 days for both in ≤100,000 c/mL at BL strata, and 113 vs 169 days for BL >100,000 c/mL subgroup.
Conclusions: DTG/3TC and DTG+TDF/FTC had similar proportions of TND by snapshot at all weeks. Snapshot response rates based on TND status at Week 48 were similar between arms at ≤100,000 c/mL BL subgroup and higher for DTG/3TC in >100,000 c/mL BL category. Median time to TND was similar overall and in BL VL ≤100,000 c/mL subgroup, and less for DTG/3TC vs DTG+TDF/FTC if >100,000 c/mL at BL. These data, utilizing a more stringent snapshot criteria, continue to demonstrate the effectiveness and potency of DTG+3TC in treatment-naive patients.
Data included in this abstract have been previously presented at the Conference on Retroviruses and Opportunistic Infections; March 4-7, 2019; Seattle, WA, USA.
Dr. Aliya Utegenova
Doctor
Kazakh Scientific Center Of Dermatology And Infection Diseases
The activities of friendly offices in the Republic of Kazakhstan
Abstract
In order to ensure access of vulnerable groups of population (IDU, SW, MSM) and young adults to diagnostics and treatment of STIs on a free, confidential and anonymous basis, there are 31 friendly offices (FO) in the country (2017-32), 25 of which are located at the AIDS centers, and 6 are at the other medical organizations (venereal and skin clinics, antenatal clinics, polyclinics).
In 2018, 24641 people appealed to friendly offices (2017 - 28068). From the number of persons who applied to FO, 43.5% are SW (2017–44.7%), 5.9% - MSM (2017–4.6%), 22.5% - IDU (2017–26.4 %), 22.2% are young people (2017–20%) and 5.7% of PLHIV (2017–4.2%). In 45.6% (2017-47.8%) of the persons who applied, one or more STI syndromes were confirmed by laboratory. 15.8% of clients were sent to the STI clinics to clarify the diagnosis (2017 - 15.4%). The number of clients surveyed for STIs - 22,156 people, of which 50.7% were diagnosed with STIs (2017 - 51.5%), and 97% received treatment (2017 - 94.3%) . Pre-test counseling was carried out for 23053 people, of which 62.7% were tested for HIV by a rapid test method (2017 - 66.8%).
According to the data, it can be observed that the detectability of STIs and HIV infection is increasing; syphilis has significantly increased among MSM, 8.5% of cases (2017- 2.9%), and slightly increased among HIV, 1.8% (2017-1.4%). Among PLHIV, gonorrhea and syphilis increased by almost 2 times compared with last year. HIV infection has increased among young people, which is why strengthening prevention work among this category is especially important.
Thus, in spite of the fact that the number of people covered with medical services has decreased compared to last year, the incidence of STIs and HIV infection among key populations is increasing.
In this regard, it is necessary to strengthen the activities of Friendly Offices, revise the diagnostic algorithms for STIs and treatment protocols in accordance with international recommendations, increase the budget for the purchase of diagnostic consumables and drugs, and take preventive measures in relation to STIs and HIV infection.
In 2018, 24641 people appealed to friendly offices (2017 - 28068). From the number of persons who applied to FO, 43.5% are SW (2017–44.7%), 5.9% - MSM (2017–4.6%), 22.5% - IDU (2017–26.4 %), 22.2% are young people (2017–20%) and 5.7% of PLHIV (2017–4.2%). In 45.6% (2017-47.8%) of the persons who applied, one or more STI syndromes were confirmed by laboratory. 15.8% of clients were sent to the STI clinics to clarify the diagnosis (2017 - 15.4%). The number of clients surveyed for STIs - 22,156 people, of which 50.7% were diagnosed with STIs (2017 - 51.5%), and 97% received treatment (2017 - 94.3%) . Pre-test counseling was carried out for 23053 people, of which 62.7% were tested for HIV by a rapid test method (2017 - 66.8%).
According to the data, it can be observed that the detectability of STIs and HIV infection is increasing; syphilis has significantly increased among MSM, 8.5% of cases (2017- 2.9%), and slightly increased among HIV, 1.8% (2017-1.4%). Among PLHIV, gonorrhea and syphilis increased by almost 2 times compared with last year. HIV infection has increased among young people, which is why strengthening prevention work among this category is especially important.
Thus, in spite of the fact that the number of people covered with medical services has decreased compared to last year, the incidence of STIs and HIV infection among key populations is increasing.
In this regard, it is necessary to strengthen the activities of Friendly Offices, revise the diagnostic algorithms for STIs and treatment protocols in accordance with international recommendations, increase the budget for the purchase of diagnostic consumables and drugs, and take preventive measures in relation to STIs and HIV infection.
Dr. Cristina Valente
Doctor
Ch Univ Coimbra - Huc
HEV infection in Portuguese HIV-infected patients
Abstract
Introduction: Despite rare cases of chronic hepatitis E described in the literature, the seroprevalence of Hepatitis E virus (HEV) and its chronicity rate in the HIV-infected individuals has not been well established.
Material and Methods: with the aim of knowing the prevalence and chronicity rate of HEV, the authors investigated 160 HIV-infected patients attending the out-patient clinic of a central hospital in Coimbra, during a six month period. All randomly included patients were tested for anti-HEV IgM/IgG (recomLine –Mikrogenm) and RT-PCR. Levels of CD4 cell count, HIV viral load, ART, HBV and HCV co-infection, as well as demographic features were analyzed, to find out if any factor is associated with higher prevalence.
Results: One hundred and sixty HIV patients were tested, mainly male (83,1%) with an average age of 51,5 years old. All patients were under ART, and 93,1% had undetectable HIV RNA. Anti-HEV IgG was found in 29 patients (18,1%) and none of the total had detectable HEV RNA. Patients with IgG+ were older than those with IgG- (p 0.03). CD4 cell count at the time of HIV diagnosis and in the present had no statistically difference between anti-HEV IgG+ /– [453/mm3 vs 410/mm3 initially (p 0.470) and 594/mm3 vs 640/mm3 in the present (p 0.244)], as also when analyzing the level < 200/mm3 at diagnosis (p 0.72). There were no differences in IgG+ or IgG- in initial HIV viral load (165 659 cp/ml vs 97 179 cp/ml, p 0.654), in the HBV coinfection (3,4% vs 3,1%), HCV coinfection (37,9% vs 36,5%) or HAV prevalence (82,8% vs 83,2%). There was only one case of cirrhosis (3,4%) in IgG+ group, also infected with HCV and treated with SVR, contrasting with 7 cases (5,3%) in IgG- group. No statistically differences in AST or ALT levels were found in both groups.
Conclusions: The HEV seroprevalence in this sample was 18,1%. No chronic hepatitis was found of the exclusive responsibility of HEV. Higher prevalence was not associated with lower level of CD4, higher viremia or co-infections with other virus; age was the only independent factor associated with anti-HEV IgG+. Although HEV prevalence is high in this population, chronic HEV infection may be considered uncommon chronic liver disease in HIV-infected individuals.
Material and Methods: with the aim of knowing the prevalence and chronicity rate of HEV, the authors investigated 160 HIV-infected patients attending the out-patient clinic of a central hospital in Coimbra, during a six month period. All randomly included patients were tested for anti-HEV IgM/IgG (recomLine –Mikrogenm) and RT-PCR. Levels of CD4 cell count, HIV viral load, ART, HBV and HCV co-infection, as well as demographic features were analyzed, to find out if any factor is associated with higher prevalence.
Results: One hundred and sixty HIV patients were tested, mainly male (83,1%) with an average age of 51,5 years old. All patients were under ART, and 93,1% had undetectable HIV RNA. Anti-HEV IgG was found in 29 patients (18,1%) and none of the total had detectable HEV RNA. Patients with IgG+ were older than those with IgG- (p 0.03). CD4 cell count at the time of HIV diagnosis and in the present had no statistically difference between anti-HEV IgG+ /– [453/mm3 vs 410/mm3 initially (p 0.470) and 594/mm3 vs 640/mm3 in the present (p 0.244)], as also when analyzing the level < 200/mm3 at diagnosis (p 0.72). There were no differences in IgG+ or IgG- in initial HIV viral load (165 659 cp/ml vs 97 179 cp/ml, p 0.654), in the HBV coinfection (3,4% vs 3,1%), HCV coinfection (37,9% vs 36,5%) or HAV prevalence (82,8% vs 83,2%). There was only one case of cirrhosis (3,4%) in IgG+ group, also infected with HCV and treated with SVR, contrasting with 7 cases (5,3%) in IgG- group. No statistically differences in AST or ALT levels were found in both groups.
Conclusions: The HEV seroprevalence in this sample was 18,1%. No chronic hepatitis was found of the exclusive responsibility of HEV. Higher prevalence was not associated with lower level of CD4, higher viremia or co-infections with other virus; age was the only independent factor associated with anti-HEV IgG+. Although HEV prevalence is high in this population, chronic HEV infection may be considered uncommon chronic liver disease in HIV-infected individuals.
Prof. Annemarie Wensing
Clinical Virologist
UMC Utrecht/University of the Witwatersrand
Extensive Pre-treatment Drug Resistance Compromising Current First-line Regimens among HIV-infected Immigrants from LMIC Presenting in the Netherlands
Abstract
Background:
In Europe pre-treatment drug resistance has been stable around 10% since 2002, as shown by the SPREAD surveillance program. Most patients with resistance at baseline are MSM infected by subtype B virus with a single RT mutation, which has limited impact on the susceptibility to currently used regimens. With increasing use of integrase inhibitors as first-line cART, the role of baseline resistance testing has been under debate. However, recently we observed unexpected cases of extensive resistance in patients from low and middle income countries (LMIC) newly presenting in care in the Netherlands.
Methods:
We identified 11 HIV-infected patients originating from LMIC and presenting in 4 HIV care centers in the Netherlands (Groningen, Tilburg, Zwolle and Utrecht) in the past 5 years with unexpected extensive pre-treatment resistance profiles. Clinical data were obtained from the ATHENA cohort. Sanger sequencing was performed and results interpreted with Stanford HIVdb v8.6.1.
Results:
The majority was male (n=8) and diagnosed with HIV-1 at a mean age of 34 years (range 20-49). Seven patients originated from Sub-Saharan Africa and reported to be infected via heterosexual contact. Four patients were MSM and originated from the Caribbean (n=3) and Latin America (n=1). They presented in the Netherlands in 2012 (n=1), 2014 (n=1), 2016 (n=3) and 2018 (n=6). At presentation, seven patients had a CD4 count below 350 cells/mm3 (median:212, range:27-489). They were infected with subtype A (n=2), B (n=2), C, D, G and various CRFs (n=4). Genotypic testing revealed a median of 7 mutations in RT, most frequently M184V (n=7), T215Y/F (n=5), and Y181C (n=6). This resulted in predicted high-level or intermediate resistance to all NRTIs available (n=5), high-level resistance to emtricitabine and lamivudine (n=2), or susceptibility to zidovudine only (n=1). In ten patients high-level or intermediate resistance to all available NNRTIs (n=9) or nevirapine and efavirenz only (n=1) was observed. In one patient the major protease mutation 54V was detected predicting low-level resistance to atazanavir and lopinavir. The majority did not report a prior treatment history before presentation in the Netherlands. Based on resistance testing, most patients were switched to a 3-class regimen including a protease inhibitor, integrase inhibitor and either an optimized NRTI backbone or maraviroc.
Conclusion:
We have observed an increasing number of patients from LMIC who present in the Netherlands with extensive pre-treatment drug resistance, compromising the efficacy of the NRTI backbone used as part of the current recommended first-line regimens in our setting. Physicians should be aware that with the roll-out of cART in LMIC, patients originating from these settings are at risk of extensive pre-treatment drug resistance due to either (undisclosed) prior treatment in their country of origin or transmitted resistance. Baseline resistance testing should be highly recommended in these patients.
In Europe pre-treatment drug resistance has been stable around 10% since 2002, as shown by the SPREAD surveillance program. Most patients with resistance at baseline are MSM infected by subtype B virus with a single RT mutation, which has limited impact on the susceptibility to currently used regimens. With increasing use of integrase inhibitors as first-line cART, the role of baseline resistance testing has been under debate. However, recently we observed unexpected cases of extensive resistance in patients from low and middle income countries (LMIC) newly presenting in care in the Netherlands.
Methods:
We identified 11 HIV-infected patients originating from LMIC and presenting in 4 HIV care centers in the Netherlands (Groningen, Tilburg, Zwolle and Utrecht) in the past 5 years with unexpected extensive pre-treatment resistance profiles. Clinical data were obtained from the ATHENA cohort. Sanger sequencing was performed and results interpreted with Stanford HIVdb v8.6.1.
Results:
The majority was male (n=8) and diagnosed with HIV-1 at a mean age of 34 years (range 20-49). Seven patients originated from Sub-Saharan Africa and reported to be infected via heterosexual contact. Four patients were MSM and originated from the Caribbean (n=3) and Latin America (n=1). They presented in the Netherlands in 2012 (n=1), 2014 (n=1), 2016 (n=3) and 2018 (n=6). At presentation, seven patients had a CD4 count below 350 cells/mm3 (median:212, range:27-489). They were infected with subtype A (n=2), B (n=2), C, D, G and various CRFs (n=4). Genotypic testing revealed a median of 7 mutations in RT, most frequently M184V (n=7), T215Y/F (n=5), and Y181C (n=6). This resulted in predicted high-level or intermediate resistance to all NRTIs available (n=5), high-level resistance to emtricitabine and lamivudine (n=2), or susceptibility to zidovudine only (n=1). In ten patients high-level or intermediate resistance to all available NNRTIs (n=9) or nevirapine and efavirenz only (n=1) was observed. In one patient the major protease mutation 54V was detected predicting low-level resistance to atazanavir and lopinavir. The majority did not report a prior treatment history before presentation in the Netherlands. Based on resistance testing, most patients were switched to a 3-class regimen including a protease inhibitor, integrase inhibitor and either an optimized NRTI backbone or maraviroc.
Conclusion:
We have observed an increasing number of patients from LMIC who present in the Netherlands with extensive pre-treatment drug resistance, compromising the efficacy of the NRTI backbone used as part of the current recommended first-line regimens in our setting. Physicians should be aware that with the roll-out of cART in LMIC, patients originating from these settings are at risk of extensive pre-treatment drug resistance due to either (undisclosed) prior treatment in their country of origin or transmitted resistance. Baseline resistance testing should be highly recommended in these patients.
Mr. Piotr Zabek
Research Assistant
Hospital For Infectious Diseases, Molecular Diagnostic Laboratory
Distribution of high risk HPV genotypes among HIV positive patients in Outpatient Clinic, Warsaw, Poland
Abstract
Introduction/Background
Human papillomavirus (HPV) infection is a common sexually transmitted disease worldwide. HIV positive patients are exposed for persisted HPV infection because of their immunological impairment. Detection and genotyping of high risk (HR) HPV strains are part of integrated gynaecological care (IGC) established at the HIV Outpatient Clinic in Hospital for Infectious Diseases in Warsaw. The aim of this study was to determine prevalence and genetic distribution of HR-HPV among HIV positive patients.
Materials/Methods
Two hundred ninety cervical swabs samples obtained from 290 (93,85%) women and 19 tissue biopsies obtained from 19 men (6,15%), treated in our Clinic since 2016 to 2018, were analysed. Cervical swabs were taken during a routine, once per year, visit; tissue biopsies were collected only when clinical symptoms of HPV infection were observed . The median age of study participants was 40 years (IQR:36–46) and median CD4 count was 584,5 cells/µL (IQR:393-782,5). Eighty four percent patients had undetectable or <40 copies/mL HIV viral load, 16% had HIV VL ≥40 copies/mL and median VL was 5205 copies/mL (IQR:147-34514). HPV DNA detection and genotyping was performed using HPV Genotypes 14 Real-TM Quant kit (Sacace, Italy). The test enables following genotypes detection: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68. PCR reactions were carried on CFX96 cycler (BioRad, USA). Obtained results were analyzed using software provided by manufacturer.
Results
The HR HPV DNA was found in 42,75% (124/290; 95% CI:37,05-48,46%) cervical swabs and in 89% (17/19) tissue biopsy samples. The most frequent genotypes among women were: 16 - 20%(25/124) and 68 - 18,5%(23/124); among men: 16 - 65%(11/17) and 59 - 29,5%(5/17). Genotype 18 was detected in 5,6%(7/124) women and in 17,6%(3/17) men. In cervical swabs samples mixed HPV genotypes were detected: 2 genotypes (22,7%-28/124), 3 genotypes (9,7%-12-124), 4 (4,8%-6/124) and 5 (1,6%-2/124). In tissue biopsies mixed infections were more frequent than monoinfections - 58,9%-10/17 (2 to 7 genotypes) versus 41,1%-7/10. The most complex infections contained following genotypes: 39, 52, 56, 66, 68 (female, CD4 628 cells/µL; HIV RNA 5208 copies/mL), 16, 33, 39, 51, 66 (female, CD4 626 cells/µL; undetectable HIV RNA) and 18, 31, 39, 45, 52, 59, 68 (male, CD4 698 cells/µL, HIV RNA <40 copies/mL). In the tested group the longest duration of HPV infection was determined as at least for 3 years (genotype 56).
Conclusions
Our work documents HPV prevalence and genotype distribution in poorly characterized, for that pathogen, group of HIV infected patients in Central Poland. Analysis revealed that HPV-16 infection was more frequent than HPV-18 in both¸ women and men, groups of patients. Additionally, mixed infections (≥2 genotypes) were common in analysed cohort; in some cases 6-7 genotypes were detected simultaneously. Furthermore, we document that HPV infection could be established for at least 3 years. However, common anti-HPV vaccination probably will change the prevalence and genotypes distribution of HR-HPV in the future, also in the group of HIV positive patients. Therefore long-time surveillance is necessary to recognize upcoming trends and changes.
Human papillomavirus (HPV) infection is a common sexually transmitted disease worldwide. HIV positive patients are exposed for persisted HPV infection because of their immunological impairment. Detection and genotyping of high risk (HR) HPV strains are part of integrated gynaecological care (IGC) established at the HIV Outpatient Clinic in Hospital for Infectious Diseases in Warsaw. The aim of this study was to determine prevalence and genetic distribution of HR-HPV among HIV positive patients.
Materials/Methods
Two hundred ninety cervical swabs samples obtained from 290 (93,85%) women and 19 tissue biopsies obtained from 19 men (6,15%), treated in our Clinic since 2016 to 2018, were analysed. Cervical swabs were taken during a routine, once per year, visit; tissue biopsies were collected only when clinical symptoms of HPV infection were observed . The median age of study participants was 40 years (IQR:36–46) and median CD4 count was 584,5 cells/µL (IQR:393-782,5). Eighty four percent patients had undetectable or <40 copies/mL HIV viral load, 16% had HIV VL ≥40 copies/mL and median VL was 5205 copies/mL (IQR:147-34514). HPV DNA detection and genotyping was performed using HPV Genotypes 14 Real-TM Quant kit (Sacace, Italy). The test enables following genotypes detection: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68. PCR reactions were carried on CFX96 cycler (BioRad, USA). Obtained results were analyzed using software provided by manufacturer.
Results
The HR HPV DNA was found in 42,75% (124/290; 95% CI:37,05-48,46%) cervical swabs and in 89% (17/19) tissue biopsy samples. The most frequent genotypes among women were: 16 - 20%(25/124) and 68 - 18,5%(23/124); among men: 16 - 65%(11/17) and 59 - 29,5%(5/17). Genotype 18 was detected in 5,6%(7/124) women and in 17,6%(3/17) men. In cervical swabs samples mixed HPV genotypes were detected: 2 genotypes (22,7%-28/124), 3 genotypes (9,7%-12-124), 4 (4,8%-6/124) and 5 (1,6%-2/124). In tissue biopsies mixed infections were more frequent than monoinfections - 58,9%-10/17 (2 to 7 genotypes) versus 41,1%-7/10. The most complex infections contained following genotypes: 39, 52, 56, 66, 68 (female, CD4 628 cells/µL; HIV RNA 5208 copies/mL), 16, 33, 39, 51, 66 (female, CD4 626 cells/µL; undetectable HIV RNA) and 18, 31, 39, 45, 52, 59, 68 (male, CD4 698 cells/µL, HIV RNA <40 copies/mL). In the tested group the longest duration of HPV infection was determined as at least for 3 years (genotype 56).
Conclusions
Our work documents HPV prevalence and genotype distribution in poorly characterized, for that pathogen, group of HIV infected patients in Central Poland. Analysis revealed that HPV-16 infection was more frequent than HPV-18 in both¸ women and men, groups of patients. Additionally, mixed infections (≥2 genotypes) were common in analysed cohort; in some cases 6-7 genotypes were detected simultaneously. Furthermore, we document that HPV infection could be established for at least 3 years. However, common anti-HPV vaccination probably will change the prevalence and genotypes distribution of HR-HPV in the future, also in the group of HIV positive patients. Therefore long-time surveillance is necessary to recognize upcoming trends and changes.